S100A2 cDNA ORF Clone, Human, N-HA tag

Price:
Size:
Number:

S100A2 cDNA ORF Clone, Human, N-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
294 bp
Description
Full length Clone DNA of Human S100 calcium binding protein A2 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

S100A2 cDNA ORF Clone, Human, N-HA tag: Alternative Names

CAN19 cDNA ORF Clone, Human; S100L cDNA ORF Clone, Human

S100A2 Background Information

The calcium-binding Protein S1A2 is a member of the S1 family of proteins containing 2 EF-hand calcium-binding motifs. S1 family genes are located as a cluster on chromosome 1q21, and S1 proteins consisting of at least 2 members are involved in the regulation of a number of cellular processes such as cell-cycle progression and cell differentiation. S1A2 was first detected in lung and kidney, and is mainly expressed in a subset of tissues and cells such as breast epithelia and liver. The S1A2 protein is a homodimer that undergoes a conformational change upon binding of calcium, and the active form functions in regulating cell proliferation and differentiation, gene transcription, and p53-dependent growth arrest and apoptosis. Accordingly, this protein is regarded as a putative tumor suppressor, and thus chromosomal rearrangements and reduced expression of S1A2 gene have been implicated in certain carcinomas.
Full Name
S100 calcium binding protein A2
References
  • Gimona, M. et al., 1997, J. Cell. Sci. 110: 611-621.
  • Mueller, A. et al., 2005, J. Biol. Chem. 280: 29186-29193.
  • Lapi, E. et al., 2006, Oncogene. 25: 3628-3637.
  • Feng, G. et al., 2001, Cancer. Res. 61: 7999-8004.
  • Gupta, S. et al., 2003, J. Clin. Oncol. 21: 106-112.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait