RET cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag tag

1/2
Price:
Size:
Number:

RET cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3345 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human ret proto-oncogene, transcript variant 2 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
HindIII + XbaI (6kb + 3.35kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

RET cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RET cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.

RET cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag tag: Alternative Names

CDHF12 cDNA ORF Clone, Human; CDHR16 cDNA ORF Clone, Human; HSCR1 cDNA ORF Clone, Human; MEN2A cDNA ORF Clone, Human; MEN2B cDNA ORF Clone, Human; MTC1 cDNA ORF Clone, Human; PTC cDNA ORF Clone, Human; RET-ELE1 cDNA ORF Clone, Human; RET51 cDNA ORF Clone, Human

RET Background Information

RET proto-oncogene, also known as RET, is a cell-surface molecule that transduce signals for cell growth and differentiation. It contains 1 cadherin domain and 1 protein kinase domain. RET proto-oncogene belongs to the protein kinase superfamily, tyr protein kinase family. RET proto-oncogene is involved in numerous cellular mechanisms including cell proliferation, neuronal navigation, cell migration, and cell differentiation upon binding with glial cell derived neurotrophic factor family ligands. It phosphorylates PTK2/FAK1 and regulates both cell death/survival balance and positional information. RET is required for the molecular mechanisms orchestration during intestine organogenesis; involved in the development of enteric nervous system and renal organogenesis during embryonic life; promotes the formation of Peyer's patch-like structures; modulates cell adhesion via its cleavage; involved in the development of the neural crest. RET proto-oncogene is active in the absence of ligand, triggering apoptosis. RET acts as a dependence receptor; in the presence of the ligand GDNF in somatotrophs (within pituitary), promotes survival and down regulates growth hormone (GH) production, but triggers apoptosis in absence of GDNF. It also regulates nociceptor survival and size; triggers the differentiation of rapidly adapting (RA) mechanoreceptors; mediated several diseases such as neuroendocrine cancers. Defects in RET may cause colorectal cancer, hirschsprung disease type 1, medullary thyroid carcinoma, multiple neoplasia type 2B, susceptibility to pheochromocytoma, multiple neoplasia type 2A, thyroid papillary carcinoma and congenital central hypoventilation syndrome.
Full Name
ret proto-oncogene
References
  • Schulten HJ, et al. (2011) Mutational screening of RET, HRAS, KRAS, NRAS, BRAF, AKT1, and CTNNB1 in medullary thyroid carcinoma. Anticancer Res. 31(12):4179-83.
  • Ciampi R, et al. (2012) Chromosome 10 and RET gene copy number alterations in hereditary and sporadic Medullary Thyroid Carcinoma. Mol Cell Endocrinol. 348(1):176-82.
  • Garcia-Lavandeira M, et al. (2012) Craniopharyngiomas express embryonic stem cell markers (SOX2, OCT4, KLF4, and SOX9) as pituitary stem cells but do not coexpress RET/GFRA3 receptors. J Clin Endocrinol Metab. 97(1):E80-7.
  • Stine ZE, et al. (2011) Steroid hormone modulation of RET through two estrogen responsive enhancers in breast cancer. Hum Mol Genet. 20(19):3746-56.
  • Sharma BP, et al. (2011) RET gene mutations and polymorphisms in medullary thyroid carcinomas in Indian patients. J Biosci. 36(4):603-11.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait