PIGR cDNA ORF Clone, Human, N-Myc tag

Price:
Size:
Number:

PIGR cDNA ORF Clone, Human, N-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2295 bp
Description
Full length Clone DNA of Human polymeric immunoglobulin receptor with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PIGR cDNA ORF Clone, Human, N-Myc tag: Alternative Names

FLJ22667 cDNA ORF Clone, Human; MGC125361 cDNA ORF Clone, Human; MGC125362 cDNA ORF Clone, Human; PIGR cDNA ORF Clone, Human

PIGR Background Information

Polymeric immunoglobulin receptor, also known asPIGR, is a member of the immunoglobulin superfamilyand aFc receptor. The ectodomain of this receptor consists of five units with homology to the variable units of immunoglobulins and a transmembrane region, which also has some homology to certain immunoglobulin variable regions. PIGR is expressed on several glandular epithelia including those of liver and breast. The deduced amino-acid sequence has a length of 764 residues and shows an overall similarity of 56% and 64% with the rabbit and rat counterpart. PIGR mediates transcellular transport of polymeric immunoglobulin molecules, and thus facilitates the secretion ofIgAandIgM. During this process, a cleavage occurs that separates the extracellular (known as the secretory component) from the transmembrane segment of PIGR.
Full Name
polymeric immunoglobulin receptor
References
  • Coyne, R. S. et al., 1995, J. Biol. Chem. 269 (50) :31620-31625. 
  • Kaetzel,C.S., 2001,  Curr Biol. 11(1): R35-38.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait