IMMT/Mitofilin cDNA ORF Clone, Human, N-OFPSpark® tag

1/1
Price:
Size:
Number:

IMMT/Mitofilin cDNA ORF Clone, Human, N-OFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2964 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human inner membrane protein, mitochondrial with N terminal OFPSpark / RFP tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI(6kb+2.96kb)
Tag Sequence
OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IMMT/Mitofilin cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IMMT/Mitofilin cDNA ORF Clone, Human, N-OFPSpark® tag: Validated Images

IMMT/Mitofilin cDNA ORF Clone, Human, N-OFPSpark® tag: Alternative Names

HMP cDNA ORF Clone, Human; Mic60 cDNA ORF Clone, Human; MINOS2 cDNA ORF Clone, Human; P87 cDNA ORF Clone, Human; P87/89 cDNA ORF Clone, Human; P89 cDNA ORF Clone, Human; PIG4 cDNA ORF Clone, Human; PIG52 cDNA ORF Clone, Human

IMMT/Mitofilin Background Information

Full Name
inner membrane protein, mitochondrial
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait