FCRL1 cDNA ORF Clone, Human, N-Myc tag

Price:
Size:
Number:

FCRL1 cDNA ORF Clone, Human, N-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1290 bp
Description
Full length Clone DNA of Human chemokine (C-X-C motif) receptor 7 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

FCRL1 cDNA ORF Clone, Human, N-Myc tag: Alternative Names

CD307a cDNA ORF Clone, Human; FCRH1 cDNA ORF Clone, Human; IFGP1 cDNA ORF Clone, Human; IRTA5 cDNA ORF Clone, Human

FCRL1 Background Information

Fc receptor-like protein 1, also known as FcR-like protein 1, Fc receptor homolog 1, IFGP family protein 1, Immune receptor translocation-associated protein 5 and FCRL1, is a single-pass type I membrane protein which contains threeIg-like C2-type (immunoglobulin-like) domains. It is a cell-surface membrane protein belonging to FCRL family and is preferentially expressed on B cells. FCRL1 is primarily expressed in secondary lymphoid tissues by mature subsets of B cells. It is detected in spleen, lymph node, heart, skeletal muscle, kidney, liver and placenta. FCRL1 is specifically expressed by mature B lineage cells with higher expression in naive versus memory B cells (at protein level). Human Fc receptor-like molecules (FCRL1, FCRL2, FCRL3, FCRL4, FCRL5) have tyrosine-based immunoregulatory potential and are expressed by B-lineage subpopulations. FCRL1 may function as an activating coreceptor in B cells. It may also function in B cells activation and differentiation.
Full Name
Fc receptor-like 1
References
  • Du X. et al., 2008, Blood. 111 (1): 338-43.
  • Kazemi T. et al., 2008, Int J Cancer. 123 (9): 2113-9.
  • Baranov K. et al., 2008, J Immunol Methods. 332 (1-2): 73-81.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait