Her2 / ERBB2 cDNA ORF Clone, Human, untagged

1/1
Price:
Size:
Number:

Her2 / ERBB2 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3768 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian), transcript variant 1.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
HindIII + XbaI(6.1kb+3.77kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Her2 / ERBB2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Her2 / ERBB2 cDNA ORF Clone, Human, untagged: Validated Images

Her2 / ERBB2 cDNA ORF Clone, Human, untagged: Alternative Names

CD340 cDNA ORF Clone, Human; ENV cDNA ORF Clone, Human; ENVW cDNA ORF Clone, Human; ERVWE1 cDNA ORF Clone, Human; HER-2 cDNA ORF Clone, Human; HER-2/neu cDNA ORF Clone, Human; HER2 cDNA ORF Clone, Human; HERV-7q cDNA ORF Clone, Human; HERV-W-ENV cDNA ORF Clone, Human; HERV7Q cDNA ORF Clone, Human; HERVW cDNA ORF Clone, Human; HERVWENV cDNA ORF Clone, Human; MLN 19 cDNA ORF Clone, Human; MLN19 cDNA ORF Clone, Human; NEU cDNA ORF Clone, Human; NGL cDNA ORF Clone, Human; TKR1 cDNA ORF Clone, Human

Her2 / ERBB2 Background Information

Epidermal growth factor receptor 2 (HER2), also known as ErbB2, NEU, and CD34, is a type I membrane glycoprotein, and belongs to the epidermal growth factor (EGF) receptor family. HER2 protein cannot bind growth factors due to the lacking of ligand binding domain of its own and autoinhibited constitutively. However, HER2 forms a heterodimer with other ligand-bound EGF receptor family members, therefore stabilizes ligand binding and enhances kinase-mediated activation of downstream molecules. HER2 plays a key role in development, cell proliferation and differentiation. HER2 gene has been reported to associate with malignancy and a poor prognosis in numerous carcinomas, including breast, prostate, ovarian, lung cancers and so on.
Full Name
erb-b2 receptor tyrosine kinase 2
References
  • Krawczyk N, et al. (2009) HER2 status on persistent disseminated tumor cells after adjuvant therapy may differ from initial HER2 status on primary tumor. Anticancer Res. 29(10): 4019-24.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait