C5a cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag tag

Price:
Size:
Number:

C5a cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
5031 bp
Description
Full length Clone DNA of Human complement component 5 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

C5a cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag tag: Alternative Names

C5a cDNA ORF Clone, Human; C5b cDNA ORF Clone, Human; C5D cDNA ORF Clone, Human; C5Da cDNA ORF Clone, Human; Complement 5a cDNA ORF Clone, Human; CPAMD4 cDNA ORF Clone, Human; ECLZB cDNA ORF Clone, Human

C5a Background Information

C5a is a protein fragment released from complement component C5. This 74 amino acid peptide in humans is generated by the cleavage of C5a convertase on the C5 α-chain during the classical, alternative, and lectin pathways of complement activation. The structure of C5a includes a core region consisting of four, anti-parallel alpha-helices held together by three disulfide linkages and a structured C-terminal tail, and C5a is rapidly metabolised by carboxypeptidase B to a 73 amino acid low activity form, C5a des-Arg. C5a is an extremely potent proinflammatory mediator, as well as a potent chemotactic factor for neutrophils and other leukocytes. It causes histamine release, increases in vascular permeability, induces several cytokines production from leukocytes, enhances neutrophil-endothelial cell adhesion, and augments the humoral and cell-mediated immune response. C5a is quickly metabolised by carboxypeptidases, forming the less potent C5adesArg. Acting via a classical G protein-coupled receptor, CD88, C5a and C5adesArg exert a number of effects essential to the innate immune response, while their actions at the more recently discovered non-G protein-coupled receptor, C5L2 (or GPR77), remain unclear. The widespread expression of C5a receptors throughout the body allows C5a to elicit a broad range of effects. Thus, C5a has been found to be a significant pathogenic driver in a number of immuno-inflammatory diseases, making C5a inhibition an attractive therapeutic strategy. C5a is a strong chemoattractant and is involved in the recruitment of inflammatory cells such as neutrophils, eosinophils, monocytes, and T lymphocytes, in activation of phagocytic cells and release of granule-based enzymes and generation of oxidants, all of which may contribute to innate immune functions or tissue damage. Accordingly, the anaphylatoxin C5a is implicated in a variety of diseases such as rheumatoid arthritis, systemic lupus erythematosus, reperfusion injury, Alzheimer's disease, and sepsis.
Full Name
complement component 5
References
  • Guo RF, et al.. (2005) Role of C5a in inflammatory responses. Annu Rev Immunol. 23: 821-52.
  • Guo RF, et al. (2006) C5a, a therapeutic target in sepsis. Recent Pat Antiinfect Drug Discov. 1(1): 57-65.
  • Manthey HD, et al. (2009) Complement component 5a (C5a). Int J Biochem Cell Biol. 41(11): 2114-7.

C5a cDNA ORF Clone, Rat, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait