CD46 cDNA ORF Clone, Human, N-Myc tag

1/1
Price:
Size:
Number:

CD46 cDNA ORF Clone, Human, N-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1146 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human CD46 molecule, complement regulatory protein with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI(6kb+1.15kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CD46 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD46 cDNA ORF Clone, Human, N-Myc tag: Validated Images

CD46 cDNA ORF Clone, Human, N-Myc tag: Alternative Names

AHUS2 cDNA ORF Clone, Human; MCP cDNA ORF Clone, Human; MIC10 cDNA ORF Clone, Human; TLX cDNA ORF Clone, Human; TRA2.10 cDNA ORF Clone, Human

CD46 Background Information

CD46, also known as Membrane Cofactor Protein (MCP), is a complement regulatory protein. CD46 is a type 1 membrane protein that plays an important inhibitory role in the complement system. CD46 is expressed in white blood cells, platelets, epithelial cells, and fibroblasts. Human CD46 shares 5% amino acid sequence identity with mouse and rat CD46. The importance of CD46 to complement regulation is underscored by the observation that genetic loss of CD46 leads to development of atypical hemolytic-uremic syndrome (aHUS), a disease characterized by uncontrolled complement activation. CD46 is implicated in the development and/or progression of selected cancer types.
Full Name
CD46 molecule, complement regulatory protein
References
  • Lublin D.M., et al.,(1988), Molecular cloning and chromosomal localization of human membrane cofactor protein (MCP). Evidence for inclusion in the multigene family of complement-regulatory proteins. J. Exp. Med. 168:181-194.
  • Purcell D.F., et al., (1991), Alternatively spliced RNAs encode several isoforms of CD46 (MCP), a regulator of complement activation.Immunogenetics 33:335-344.
  • Post T.W., et al.,(1991), Membrane cofactor protein of the complement system: alternative splicing of serine/threonine/proline-rich exons and cytoplasmic tails produces multiple isoforms that correlate with protein phenotype.J. Exp. Med. 174:93-102.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait