CD22 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag tag

1/2
Price:
Size:
Number:

CD22 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2067 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human CD22 molecule with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
HindIII+XbaI(6kb+2.07kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

CD22 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD22 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.

CD22 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag tag: Alternative Names

SIGLEC-2 cDNA ORF Clone, Human; SIGLEC2 cDNA ORF Clone, Human

CD22 Background Information

CD22 is a member of the immunoglobulin superfamily, SIGLEC family of lectins. It is first expressed in the cytoplasm of pro-B and pre-B cells, and on the surface as B cells mature to become IgD+. CD22 serves as an adhesion receptor for sialic acid-bearing ligands expressed on erythrocytes and all leukocyte classes. In addition to its potential role as a mediator of intercellular interactions, signal transduction through CD22 can activate B cells and modulate antigen receptor signaling in vitro. The phenotype of CD22-deficient mice suggests that CD22 is primarily involved in the generation of mature B cells within the bone marrow, blood, and marginal zones of lymphoid tissues. CD22 recruits the tyrosine phosphatase Src homology 2 domain-containing phosphatase 1 (SHP-1) to immunoreceptor tyrosine-based inhibitory motifs (ITIMs) and inhibits B-cell receptor (BCR)-induced Ca2+ signaling on normal B cells. CD22 interacts specifically with ligands carrying alpha2-6-linked sialic acids. As an inhibitory coreceptor of the B-cell receptor (BCR), CD22 plays a critical role in establishing signalling thresholds for B-cell activation. Like other coreceptors, the ability of CD22 to modulate B-cell signalling is critically dependent upon its proximity to the BCR, and this in turn is governed by the binding of its extracellular domain to alpha2,6-linked sialic acid ligands. However, genetic studies in mice reveal that some CD22 functions are regulated by ligand binding, whereas other functions are ligand-independent and may only require expression of an intact CD22 cytoplasmic domain at the B-cell surface. CD19 regulates CD22 phosphorylation by augmenting Lyn kinase activity, while CD22 inhibits CD19 phosphorylation via SHP-1.
Full Name
CD22 molecule
References
  • Tedder TF, et al. (1997) CD22, a B lymphocyte-specific adhesion molecule that regulates antigen receptor signaling. Annu Rev Immunol. 15: 481-504.
  • Tedder TF, et al. (2005) CD22: a multifunctional receptor that regulates B lymphocyte survival and signal transduction. Adv Immunol. 88: 1-50.
  • Fujimoto M, et al. (2007) B cell signaling and autoimmune diseases: CD19/CD22 loop as a B cell signaling device to regulate the balance of autoimmunity. J Dermatol Sci. 46(1): 1-9.
  • Walker JA, et al. (2008) CD22: an inhibitory enigma. Immunology. 123(3): 314-25.
  • Nitschke L. (2009) CD22 and Siglec-G: B-cell inhibitory receptors with distinct functions. Immunol Rev. 230(1): 128-43.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait