C7 cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

C7 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2532 bp
Description
Full length Clone DNA of Human complement component 7.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

C7 cDNA ORF Clone, Human, untagged: Alternative Names

Complement C7 cDNA ORF Clone, Human

C7 Background Information

Complement component 7 is a component of the complement system. It belongs to the complement C6/C7/C8/C9 family. It contains 1 EGF-like domain, 1 LDL-receptor class A domain, 1 MACPF domain, 2 Sushi (CCP/SCR) domains and 2 TSP type-1 domains. Complement component 7 serves as a membrane anchor. It participates in the formation of Membrane Attack Complex (MAC). People with C7 deficiency are prone to bacterial infection. It is a constituent of MAC that plays a key role in the innate and adaptive immune response by forming pores in the plasma membrane of target cells. Defects in C7 are a cause of complement component 7 deficiency (C7D). A rare defect of the complement classical pathway associated with susceptibility to severe recurrent infections, predominantly by Neisseria gonorrhoeae or Neisseria meningitidis.
Full Name
complement component 7
References
  • Bossi F, et al. (2009) C7 is expressed on endothelial cells as a trap for the assembling terminal complement complex and may exert anti-inflammatory function. Blood. 113(15):3640-8.
  • Kuijpers TW, et al. (2010) Complement factor 7 gene mutations in relation to meningococcal infection and clinical recurrence of meningococcal disease. Mol Immunol. 47(4):671-7.
  • Thomas AD, et al. (2012) Characterization of a large genomic deletion in four Irish families with C7 deficiency. Mol Immunol. 50(1-2):57-9.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait