BID cDNA ORF Clone, Human, C-GFPSpark® tag

1/1
Price:
Size:
Number:

BID cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1317 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human BH3 interacting domain death agonist with C terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI(6kb+1.32kb)
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

BID cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BID cDNA ORF Clone, Human, C-GFPSpark® tag: Validated Images

BID cDNA ORF Clone, Human, C-GFPSpark® tag: Alternative Names

FP497 cDNA ORF Clone, Human

BID Background Information

The BH3 interacting domain death agonist (BID) is a pro-apoptotic member of the Bcl-2 protein family, which contains only the BH3 domain, and is required for its interaction with the Bcl-2 family proteins and for its pro-death activity. BID is important to cell death mediated by these proteases and thus is the sentinel to protease-mediated death signals. Recent studies further indicate that Bid may be more than just a killer molecule, it could be also involved in the maintenance of genomic stability by engaging at mitosis checkpoint. BID is an integrating key regulator of the intrinsic death pathway that amplifies caspase-dependent and caspase-independent execution of neuronal apoptosis. Therefore pharmacological inhibition of BID provides a promising therapeutic strategy in neurological diseases where programmed cell death is prominent. BID is activated by Caspase 8 in response to Fas/TNF-R1 death receptor activation. Activated BID is translocated to mitochondria and induces cytochrome c release, which in turn activates downstream caspases. BID action has been proposed to involve the mitochondrial re-location of its truncated form, tBid, to facilitate the release of apoptogenic proteins like cytochrome c.
Full Name
BH3 interacting domain death agonist
References
  • Gross A. (2006) BID as a double agent in cell life and death. Cell Cycle. 5(6): 582-4.
  • Yin XM. (2007) Bid, a BH3-only multi-functional molecule, is at the cross road of life and death. Gene. 369: 7-19.
  • Esposti MD. (2002) The roles of Bid. Apoptosis. 7(5): 433-40.
  • Yin XM. (2000) Signal transduction mediated by Bid, a pro-death Bcl-2 family proteins, connects the death receptor and mitochondria apoptosis pathways. Cell Res. 10(3): 161-7.
  • Yin XM. (2000) Bid, a critical mediator for apoptosis induced by the activation of Fas/TNF-R1 death receptors in hepatocytes. J Mol Med. 78(4): 203-11.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait