Hepatitis C virus (HCV-1a) NS5B ORF mammalian expression plasmid, C-Myc tag

Price:
Size:
Number:

Hepatitis C virus (HCV-1a) NS5B ORF mammalian expression plasmid, C-Myc tag: General Information

Gene
Species
HCV
NCBI Ref Seq
RefSeq ORF Size
1773 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence NC_004102.1 (7602..9374), corresponding to amino acid sequence NP_751928.1.
Description
Full length Clone DNA of Hepatitis C virus (HCV) (serotype 1a, isolate H77) NS5B with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait