GPR56 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

GPR56 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2082 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Homo sapiens G protein-coupled receptor 56.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

GPR56 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Alternative Names

BFPP cDNA ORF Clone, Human; DKFZp781L1398 cDNA ORF Clone, Human; TM7LN4 cDNA ORF Clone, Human; TM7XN1 cDNA ORF Clone, Human; UNQ540/PRO1083 cDNA ORF Clone, Human

GPR56 Background Information

GPR56 is a member of an adhesion G protein-coupled receptor family with a very long N-terminal stalk and seven transmembrane domains. GPR56 may be a target for the treatment of type 2 diabetes. GPR56 inhibits melanoma metastatic growth by impeding the expansion of micrometastases to macrometastases. GPR56 loss of function promotes mesenchymal differentiation and radioresistance of glioma initiating cells both in vitro and in vivo.
Full Name
adhesion G protein-coupled receptor G1
References
  • Liu M., et al., 1999, Genomics 55: 296-305.
  • Huang,Y. et al., 2008, Mol Cell Biochem. 308 (1-2):133-9.
  • Li,S. et al., 2008, J Neurosci 28 (22):5817-26.
  • Jin,Z. et al., 2009, Prog Mol Biol Transl Sci. 89 :1-13.
  • Xu,L. et al., 2010, Clin Exp Metastasis. 27 (4):241-9.

GPR56 cDNA ORF Clone, Mouse, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait