DKK3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

DKK3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1050 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Mus musculus dickkopf homolog 3 (Xenopus laevis).
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

DKK3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: Alternative Names

AW061014 cDNA ORF Clone, Mouse; C87148 cDNA ORF Clone, Mouse

DKK3 Background Information

DKK3 (dickkopf related protein 3) is a member of the dickkopf-related family consisting of DKK1, DKK2, DKK3 and DKK4. It is a secreted protein, and also known as REIC (Reduced Expansion in Immortalized Cells). The DKK3 protein is proposed to function as a secreted tumor suppressor since it is downregulated in a number of cancer cells and prostate cancer tissue and may be a promising candidate molecule for therapeutic interference. DKK3 protein is also a negative regulator of beta-catenin and its downregulation contribute to an activation of the beta-catenin signaling pathway.
Full Name
dickkopf WNT signaling pathway inhibitor 3
References
  • Yue W, et al., 2008. Downregulation of Dkk3 activates beta-catenin/TCF-4 signaling in lung cancer. Carcinogenesis, 29 (1): 84-92.
  • Ding Z, et al., 2009. Promoter methylation and mRNA expression of DKK3 and WIF-1 in hepatocellular carcinoma. World J Gastroenterol, 15 (21):2595-601.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait