LIGHT cDNA ORF Clone, Cynomolgus, N-DYKDDDDK (Flag®) tag tag

Price:
Size:
Number:

LIGHT cDNA ORF Clone, Cynomolgus, N-DYKDDDDK (Flag®) tag tag: General Information

Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
723 bp
Description
Full length Clone DNA of Cynomolgus tumor necrosis factor (ligand) superfamily, member 14 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

LIGHT Background Information

LIGHT, also known as TNFSF14 or CD258, is a newly identified member of the TNF superfamily (TNFSF14) that is expressed by activated T lymphocytes, monocytes, granulocytes, spleen cells, and immature dendritic cells. TNFSF14 / LIGHT / CD258 is a type II transmembrane protein that is known to bind 2 membrane-bound TNFSF signaling receptors: HVEM, which is predominantly expressed by T cells, and lymphotoxin β receptor (LTβR), which is expressed by stromal cells and nonlymphoid hematopoietic cells. TNFSF14 / LIGHT / CD258 also binds to a soluble nonsignaling receptor, decoy receptor 3 (DcR3), which can modulate the function of LIGHT in vivo. TNFSF14 / LIGHT / CD258 can also costimulate T cell responses via HVEM, which is constitutively expressed in most lymphocyte subpopulations, including CD4+ and CD8+ T cells. In addition, TNFSF14 / LIGHT / CD258 has been shown to suppress tumor formation in vivo and to induce tumor cell apoptosis via the up-regulation of intercellular adhesion molecule 1 and an increased lymphocyte adhesion to cancer cells. Thus, TNFSF14 / LIGHT / CD258 is being actively investigated as a possible basis for cancer treatment.
Full Name
tumor necrosis factor (ligand) superfamily, member 14
Research Areas
References
  • Ogawa T, et al. (2010) CXCR3 binding chemokine and TNFSF14 over expression in bladder urothelium of patients with ulcerative interstitial cystitis. J Urol. 183(3): 1206-12.
  • Kanodia S, et al. (2010) Expression of LIGHT/TNFSF14 combined with vaccination against human papillomavirus Type 16 E7 induces significant tumor regression. Cancer Res. 70(10): 3955-64.
  • Hosokawa Y, et al. (2010) TNFSF14 coordinately enhances CXCL10 and CXCL11 productions from IFN-gamma-stimulated human gingival fibroblasts. Mol Immunol. 47(4): 666-70.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait