Sino Biological - 官方網站

AKT2 cDNA ORF Clone, Human, N-GFPSpark® tag

1/2
Price:
Size:
Number:

AKT2 cDNA ORF Clone, Human, N-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1446 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human v-akt murine thymoma viral oncogene homolog 2 with N terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6kb + 2.18kb)
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

AKT2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

AKT2 cDNA ORF Clone, Human, N-GFPSpark® tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat#STF01) transiently. After 48 h, the fluorescent signals can be detected by fluorescence microscope. Green excitation 475/40nm, emission 535/45nm. Red excitation 560/55nm, emission 645/45nm. Orange excitation 525/45nm, emission 595/60nm.

AKT2 cDNA ORF Clone, Human, N-GFPSpark® tag: Alternative Names

HIHGHH cDNA ORF Clone, Human; PKBB cDNA ORF Clone, Human; PKBBETA cDNA ORF Clone, Human; PRKBB cDNA ORF Clone, Human; RAC-BETA cDNA ORF Clone, Human

AKT2 Background Information

AKT (AK mouse plus Transforming or Thymoma) is a frequent oncogene expressed in most tissues which includes three isoforms AKT1, AKT2, and AKT3. Hyperactivation of AKT signaling is a central key in many human cancer progressions, through modulating angiogenesis, tumor growth, and cell migration, invasion, metastasis, and chemoresistance. Among all three isoforms, AKT2 is most related to cancer cell invasion, metastasis, and survival. Amplification and overexpression of AKT2 have been shown in many cancers. Accumulating evidence shows the potential role of different miRNA involvements in cancer progression by activating or suppressing AKT2 expression. The AKT2/NAB1/SPK1 pathway is a novel regulating factor of macrophage migration and cardiac remodeling after myocardial infarction. The novel mechanism of the AKT2-PKM2-STAT3/NF-kappaB axis in the regulation of ovarian cancer progression, that both AKT2 and PKM2 may be potential targets for the treatment of ovarian cancer. AKT1 and AKT2, the AKT isoforms that are highly expressed in skeletal muscle, have distinct and overlapping functions, with AKT2 more important for insulin-stimulated glucose metabolism. In adipocytes, AKT2 versus AKT1 has greater susceptibility for insulin-mediated redistribution from cytosolic to membrane localization, and insulin also causes subcellular redistribution of AKT Substrate of 16 kDa (AS16), an AKT2 substrate and crucial mediator of insulin-stimulated glucose transport.
Full Name
v-akt murine thymoma viral oncogene homolog 2
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait