Sino Biological - 官方網站

pCMV3-SP-N-His (Suitable for secretary and membane protein expession)

pCMV3-SP-N-His Physical Map

pCMV3-SP-N-His Physical Map Comments for pCMV3-SP-N-His:
• CMV promoter: bases 250-837
• Enhancer: bases 838-1385
• SV40 early promoter: bases 2330-2699
• Hygromycin ORF: bases 2717-3742
• pUC origin: bases 4385-5058
• Kanamycin ORF: bases 5132-5947

Cloning Sites for ORF Inserting

Cloning Sites for ORF Inserting

Expression Vector pCMV3-SP-N-His Information Description

Vector Name pCMV3-SP-N-His
Vector Size 6089bp
Vector Type Mammalian Expression Vector
Expression Method Constitutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward: T7(TAATACGACTCACTATAGGG); Reverse: BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-His is recommended for constructing the N-His tag secretary and membrane proteins expression vector which containing a naïve signal peptide. An universal signal peptide is used to instead the naïve signal peptide. 

His Tag Information

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.