BCAM Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag

Price:
Size:
Number:

BCAM Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1875 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Rattus norvegicus basal cell adhesion molecule.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

BCAM Background Information

The Lutheran (Lu) blood group and basal cell adhesion molecule (BCAM) antigens are both carried by 2 glycoprotein isoforms of the immunoglobulin superfamily representing receptors for the laminin alpha(5) chain. It is a transmembrane receptor with five immunoglobulin-like domains in its extracellular region, and is therefore classified as a member of the immunoglobulin (Ig) gene family. In addition to red blood cells, Lu/BCAM proteins are expressed in endothelial cells of vascular capillaries and in epithelial cells of several tissues. BCAM/LU has a wide tissue distribution with a predominant expression in the basal layer of the epithelium and the endothelium of blood vessel walls. As designated as CD239 recently, BCAM and LU share a significant sequence similarity with the CD146 (MUC18) and CD166, and themselves are adhesion molecules that bind laminin with high affinity. Laminins are found in all basement membranes and are involved in cell differentiation, adhesion, migration, and proliferation. BCAM is upregulated following malignant transformation of some cell types in vivo and in vitro, thus being a candidate molecule involved in tumor progression. In addition, BCAM interacts with integrin in sickle red cells, and thus may potentially play a role in vaso-occlusive episodes.
Full Name
basal cell adhesion molecule (Lutheran blood group)
References
  • Kikkawa Y, et al. (2005) Review: Lutheran/B-CAM: a laminin receptor on red blood cells and in various tissues. Connect Tissue Res. 46 (4-5): 193-9.
  • El Nemer W, et al. (2007) Endothelial Lu/BCAM glycoproteins are novel ligands for red blood cell alpha4beta1 integrin: role in adhesion of sickle red blood cells to endothelial cells. Blood. 109 (8): 3544-51.
  • Colin Y, et al. (2008) Red cell and endothelial Lu/BCAM beyond sickle cell disease. Transfus Clin Biol. 15 (6): 402-5.
  • El Nemer W, et al. (2008) Role of Lu/BCAM in abnormal adhesion of sickle red blood cells to vascular endothelium. Transfus Clin Biol. 15 (1-2): 29-33.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait