Ubc13 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80719-NM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All Ubc13 Reagents

CRO Services

Product recommended


All Ubc13 Reagents

Ubc13 cDNA ORF Clone, Rat, N-Myc tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
459 bp
Description
Full length Clone DNA of Rat ubiquitin-conjugating enzyme E2N with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Ubc13 Background Information

Full Name
ubiquitin-conjugating enzyme E2N

Ubc13 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Ubc13 cDNA ORF Clone in Cloning Vector, Rat RG80719-U
Ubc13 cDNA ORF Clone, Rat, untagged RG80719-UT
Ubc13 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80719-ACG
Ubc13 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80719-ACGLN
Ubc13 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80719-ANG
Ubc13 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80719-ACR
Ubc13 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80719-ANR
Ubc13 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80719-CF
Ubc13 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80719-NF
Ubc13 cDNA ORF Clone, Rat, C-His tag RG80719-CH
Ubc13 cDNA ORF Clone, Rat, N-His tag RG80719-NH
Ubc13 cDNA ORF Clone, Rat, C-HA tag RG80719-CY
Ubc13 cDNA ORF Clone, Rat, N-HA tag RG80719-NY
Ubc13 cDNA ORF Clone, Rat, C-Myc tag RG80719-CM
Ubc13 qPCR Primer Pairs, Rat RP300683

Ubc13 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Ubc13 cDNA ORF Clone in Cloning Vector, Mouse MG52882-G
Ubc13 cDNA ORF Clone, Mouse, untagged MG52882-UT
Ubc13 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52882-ACGLN
Ubc13 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52882-ACG
Ubc13 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52882-ANG
Ubc13 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52882-ACR
Ubc13 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52882-ANR
Ubc13 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52882-CF
Ubc13 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52882-NF
Ubc13 cDNA ORF Clone, Mouse, C-His tag MG52882-CH
Ubc13 cDNA ORF Clone, Mouse, N-His tag MG52882-NH
Ubc13 cDNA ORF Clone, Mouse, C-HA tag MG52882-CY
Ubc13 cDNA ORF Clone, Mouse, N-HA tag MG52882-NY
Ubc13 cDNA ORF Clone, Mouse, C-Myc tag MG52882-CM
Ubc13 cDNA ORF Clone, Mouse, N-Myc tag MG52882-NM

Ubc13 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Ubc13 cDNA ORF Clone in Cloning Vector, Human HG16310-G
Ubc13 cDNA ORF Clone, Human, untagged HG16310-UT
Ubc13 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16310-ACGLN
Ubc13 cDNA ORF Clone, Human, C-GFPSpark® tag HG16310-ACG
Ubc13 cDNA ORF Clone, Human, N-GFPSpark® tag HG16310-ANG
Ubc13 cDNA ORF Clone, Human, C-OFPSpark® tag HG16310-ACR
Ubc13 cDNA ORF Clone, Human, N-OFPSpark® tag HG16310-ANR
Ubc13 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16310-CF
Ubc13 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16310-NF
Ubc13 cDNA ORF Clone, Human, C-His tag HG16310-CH
Ubc13 cDNA ORF Clone, Human, N-His tag HG16310-NH
Ubc13 cDNA ORF Clone, Human, C-HA tag HG16310-CY
Ubc13 cDNA ORF Clone, Human, N-HA tag HG16310-NY
Ubc13 cDNA ORF Clone, Human, C-Myc tag HG16310-CM
Ubc13 cDNA ORF Clone, Human, N-Myc tag HG16310-NM
Ubc13 qPCR Primer Pairs, Human HP105064
info info
添加购物车成功! 添加购物车失败!