Transthyretin cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80728-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Transthyretin Reagents
CRO Services
Product recommended

All Transthyretin Reagents
Transthyretin cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
444 bp
Description
Full length Clone DNA of Rat transthyretin with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Transthyretin Background Information

Prealbumin/Transthyretin, also known as ATTR, Prealbumin, TTR and PALB, is a secreted and cytoplasm protein which belongs to the Prealbumin / Transthyretin family. Prealbumin / Transthyretin is detected in serum and cerebrospinal fluid (at protein level). It is highly expressed in choroid plexus epithelial cells. It is also detected in retina pigment epithelium and liver. Each monomer of Prealbumin / Transthyretin has two 4-stranded beta sheets and the shape of a prolate ellipsoid. Antiparallel beta-sheet interactions link monomers into dimers. A short loop from each monomer forms the main dimer-dimer interaction. These two pairs of loops separate the opposed, convex beta-sheets of the dimers to form an internal channel. Prealbumin/Transthyretin is a carrier protein. It transports thyroid hormones in the plasma and cerebrospinal fluid, and also transports retinol (vitamin A) in the plasma. Defects in Prealbumin / Transthyretin are the cause of amyloidosis type 1 (AMYL1) which is a hereditary generalized amyloidosis due to Prealbumin / Transthyretin amyloid deposition. Protein fibrils can form in different tissues leading to amyloid polyneuropathies, amyloidotic cardiomyopathy, carpal tunnel syndrome, systemic senile amyloidosis. The diseases caused by mutations include amyloidotic polyneuropathy, euthyroid hyperthyroxinaemia, amyloidotic vitreous opacities, cardiomyopathy, oculoleptomeningeal amyloidosis, meningocerebrovascular amyloidosis, carpal tunnel syndrome, etc.

Full Name
transthyretin
References
  • Westermark P, et al. (1990) Fibril in senile systemic amyloidosis is derived from normal transthyretin. Proc Natl Acad Sci U S A. 87(7): 2843-5.
  • Colon W, et al. (1992) Partial denaturation of transthyretin is sufficient for amyloid fibril formation in vitro. Biochemistry. 31(36): 8654-60.
  • Hammarstrm P, et al. (2003) Prevention of transthyretin amyloid disease by changing protein misfolding energetics. Science. 299(5607): 713-6.
  • Transthyretin cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    Transthyretin cDNA ORF Clone in Cloning Vector, Canine DG70139-U

    Transthyretin cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Transthyretin cDNA ORF Clone in Cloning Vector, Rat RG80728-U
    Transthyretin cDNA ORF Clone, Rat, untagged RG80728-UT
    Transthyretin cDNA ORF Clone, Rat, C-GFPSpark® tag RG80728-ACG
    Transthyretin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80728-ACGLN
    Transthyretin cDNA ORF Clone, Rat, C-OFPSpark® tag RG80728-ACR
    Transthyretin cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80728-CF
    Transthyretin cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80728-NF
    Transthyretin cDNA ORF Clone, Rat, C-His tag RG80728-CH
    Transthyretin cDNA ORF Clone, Rat, N-His tag RG80728-NH
    Transthyretin cDNA ORF Clone, Rat, C-HA tag RG80728-CY
    Transthyretin cDNA ORF Clone, Rat, N-HA tag RG80728-NY
    Transthyretin cDNA ORF Clone, Rat, C-Myc tag RG80728-CM
    Transthyretin qPCR Primer Pairs, Rat RP300692

    Transthyretin cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Transthyretin cDNA ORF Clone in Cloning Vector, Mouse MG50958-G
    Transthyretin cDNA ORF Clone, Mouse, untagged MG50958-UT
    Transthyretin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50958-ACGLN
    Transthyretin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50958-ACG
    Transthyretin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50958-ACR
    Transthyretin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50958-CF
    Transthyretin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50958-NF
    Transthyretin cDNA ORF Clone, Mouse, C-His tag MG50958-CH
    Transthyretin cDNA ORF Clone, Mouse, N-His tag MG50958-NH
    Transthyretin cDNA ORF Clone, Mouse, C-HA tag MG50958-CY
    Transthyretin cDNA ORF Clone, Mouse, N-HA tag MG50958-NY
    Transthyretin cDNA ORF Clone, Mouse, C-Myc tag MG50958-CM
    Transthyretin cDNA ORF Clone, Mouse, N-Myc tag MG50958-NM
    Transthyretin qPCR Primer Pairs, Mouse MP200927

    Transthyretin cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Transthyretin cDNA ORF Clone in Cloning Vector, Human HG12091-G
    Transthyretin cDNA ORF Clone, Human, untagged HG12091-UT
    Transthyretin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12091-ACGLN
    Transthyretin cDNA ORF Clone, Human, C-GFPSpark® tag HG12091-ACG
    Transthyretin cDNA ORF Clone, Human, C-OFPSpark® tag HG12091-ACR
    Transthyretin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12091-CF
    Transthyretin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12091-NF
    Transthyretin cDNA ORF Clone, Human, C-His tag HG12091-CH
    Transthyretin cDNA ORF Clone, Human, N-His tag HG12091-NH
    Transthyretin cDNA ORF Clone, Human, C-HA tag HG12091-CY
    Transthyretin cDNA ORF Clone, Human, N-HA tag HG12091-NY
    Transthyretin cDNA ORF Clone, Human, C-Myc tag HG12091-CM
    Transthyretin cDNA ORF Clone, Human, N-Myc tag HG12091-NM
    Transthyretin qPCR Primer Pairs, Human HP101619
    info info
    添加购物车成功! 添加购物车失败!