TRUB2 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80755-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TRUB2 Reagents
CRO Services
Product recommended

All TRUB2 Reagents
TRUB2 cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
971 bp
Description
Full length Clone DNA of Rat TruB pseudouridine (psi) synthase homolog 2 (E. coli) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TRUB2 Background Information
Full Name
TruB pseudouridine (psi) synthase family member 2

TRUB2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TRUB2 cDNA ORF Clone in Cloning Vector, Rat RG80755-U
TRUB2 cDNA ORF Clone, Rat, untagged RG80755-UT
TRUB2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80755-ACG
TRUB2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80755-ACGLN
TRUB2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80755-ANG
TRUB2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80755-ACR
TRUB2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80755-ANR
TRUB2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80755-CF
TRUB2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80755-NF
TRUB2 cDNA ORF Clone, Rat, C-His tag RG80755-CH
TRUB2 cDNA ORF Clone, Rat, N-His tag RG80755-NH
TRUB2 cDNA ORF Clone, Rat, C-HA tag RG80755-CY
TRUB2 cDNA ORF Clone, Rat, N-HA tag RG80755-NY
TRUB2 cDNA ORF Clone, Rat, C-Myc tag RG80755-CM
TRUB2 qPCR Primer Pairs, Rat RP300719

TRUB2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TRUB2 cDNA ORF Clone in Cloning Vector, Mouse MG5A4956-U
TRUB2 cDNA ORF Clone, Mouse, untagged MG5A4956-UT
TRUB2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A4956-ACGLN
TRUB2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A4956-ACG
TRUB2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A4956-ANG
TRUB2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A4956-ACR
TRUB2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A4956-ANR
TRUB2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A4956-CF
TRUB2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A4956-NF
TRUB2 cDNA ORF Clone, Mouse, C-His tag MG5A4956-CH
TRUB2 cDNA ORF Clone, Mouse, N-His tag MG5A4956-NH
TRUB2 cDNA ORF Clone, Mouse, C-HA tag MG5A4956-CY
TRUB2 cDNA ORF Clone, Mouse, N-HA tag MG5A4956-NY
TRUB2 cDNA ORF Clone, Mouse, C-Myc tag MG5A4956-CM
TRUB2 cDNA ORF Clone, Mouse, N-Myc tag MG5A4956-NM

TRUB2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TRUB2 cDNA ORF Clone in Cloning Vector, Human HG24817-U
TRUB2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG24817-ACGLN
info info
添加购物车成功! 添加购物车失败!