Osteoprotegerin cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Cat: RG80159-NF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All Osteoprotegerin Reagents

CRO Services

Product recommended


All Osteoprotegerin Reagents

Osteoprotegerin cDNA ORF Clone, Rat, N-DDK (Flag®) tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1206 bp
Description
Full length Clone DNA of Rat tumor necrosis factor receptor superfamily, member 11b with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Osteoprotegerin Background Information

Osteoprotegerin or TNFRSF11B is a member of the TNF-receptor superfamily. This protein is an osteoblast-secreted decoy receptor that functions as a negative regulator of bone resorption. This protein specifically binds to its ligand, osteoprotegerin ligand, both of which are key extracellular regulators of osteoclast development. Studies of the mouse counterpart also suggest that this protein and its ligand play a role in lymph-node organogenesis and vascular calcification. Alternatively spliced transcript variants of this gene have been reported, but their full length nature has not been determined. Osteoprotegerin/TNFRSF11B acts as decoy receptor for RANKL and thereby neutralizes its function in osteoclastogenesis. This protein may inhibit the activation of osteoclasts and promotes osteoclast apoptosis in vitro. Bone homeostasis seems to depend on the local RANKL/OPG ratio. Osteoprotegerin/TNFRSF11B also play a role in preventing arterial calcification, act as decoy receptor for TRAIL and protect against apoptosis. TRAIL binding blocks the inhibition of osteoclastogenesis.

Full Name
tumor necrosis factor receptor superfamily member 11b
References
  • Collin-Osdoby P. (2005) Regulation of vascular calcification by osteoclast regulatory factors RANKL and osteoprotegerin. Circ Res. 95 (11): 1046-57.
  • Boyce BF, et al. (2007) Biology of RANK, RANKL, and osteoprotegerin. Arthritis Res. Ther. 9 Suppl 1: S1.
  • Blázquez-Medela AM, et al. ( 2011) Osteoprotegerin and diabetes-associated pathologies. Curr Mol Med. 11 (5): 401-16.
  • Osteoprotegerin cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Osteoprotegerin cDNA ORF Clone in Cloning Vector, Rat RG80159-G
    Osteoprotegerin cDNA ORF Clone, Rat, untagged RG80159-UT
    Osteoprotegerin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80159-ACGLN
    Osteoprotegerin cDNA ORF Clone, Rat, C-GFPSpark® tag RG80159-ACG
    Osteoprotegerin cDNA ORF Clone, Rat, C-OFPSpark® tag RG80159-ACR
    Osteoprotegerin cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80159-CF
    Osteoprotegerin cDNA ORF Clone, Rat, C-His tag RG80159-CH
    Osteoprotegerin cDNA ORF Clone, Rat, N-His tag RG80159-NH
    Osteoprotegerin cDNA ORF Clone, Rat, C-HA tag RG80159-CY
    Osteoprotegerin cDNA ORF Clone, Rat, N-HA tag RG80159-NY
    Osteoprotegerin cDNA ORF Clone, Rat, C-Myc tag RG80159-CM
    Osteoprotegerin cDNA ORF Clone, Rat, N-Myc tag RG80159-NM
    Osteoprotegerin qPCR Primer Pairs, Rat RP300154

    Osteoprotegerin cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Osteoprotegerin cDNA ORF Clone in Cloning Vector, Mouse MG52613-G
    Osteoprotegerin cDNA ORF Clone, Mouse, untagged MG52613-UT
    Osteoprotegerin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52613-ACG
    Osteoprotegerin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52613-ACGLN
    Osteoprotegerin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52613-ACR
    Osteoprotegerin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52613-CF
    Osteoprotegerin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52613-NF
    Osteoprotegerin cDNA ORF Clone, Mouse, C-His tag MG52613-CH
    Osteoprotegerin cDNA ORF Clone, Mouse, N-His tag MG52613-NH
    Osteoprotegerin cDNA ORF Clone, Mouse, C-HA tag MG52613-CY
    Osteoprotegerin cDNA ORF Clone, Mouse, N-HA tag MG52613-NY
    Osteoprotegerin cDNA ORF Clone, Mouse, C-Myc tag MG52613-CM
    Osteoprotegerin cDNA ORF Clone, Mouse, N-Myc tag MG52613-NM
    Osteoprotegerin qPCR Primer Pairs, Mouse MP202484

    Osteoprotegerin cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Osteoprotegerin cDNA ORF Clone in Cloning Vector, Human HG10271-M
    Osteoprotegerin cDNA ORF Clone, Human, untagged HG10271-UT
    Osteoprotegerin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10271-ACGLN
    Osteoprotegerin cDNA ORF Clone, Human, C-GFPSpark® tag HG10271-ACG
    Osteoprotegerin cDNA ORF Clone, Human, C-OFPSpark® tag HG10271-ACR
    Osteoprotegerin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10271-CF
    Osteoprotegerin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10271-NF
    Osteoprotegerin cDNA ORF Clone, Human, C-His tag HG10271-CH
    Osteoprotegerin cDNA ORF Clone, Human, N-His tag HG10271-NH
    Osteoprotegerin cDNA ORF Clone, Human, C-HA tag HG10271-CY
    Osteoprotegerin cDNA ORF Clone, Human, N-HA tag HG10271-NY
    Osteoprotegerin cDNA ORF Clone, Human, C-Myc tag HG10271-CM
    Osteoprotegerin cDNA ORF Clone, Human, N-Myc tag HG10271-NM
    Osteoprotegerin qPCR Primer Pairs, Human HP100319
    info info
    添加购物车成功! 添加购物车失败!