TMEM204 cDNA ORF Clone, Rat, C-His tag

Cat: RG81630-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TMEM204 Reagents
CRO Services
Product recommended

All TMEM204 Reagents
TMEM204 cDNA ORF Clone, Rat, C-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
681 bp
Description
Full length Clone DNA of Rat transmembrane protein 204 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TMEM204 Background Information
Full Name
transmembrane protein 204

TMEM204 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TMEM204 cDNA ORF Clone in Cloning Vector, Rat RG81630-G
TMEM204 cDNA ORF Clone, Rat, untagged RG81630-UT
TMEM204 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81630-ACG
TMEM204 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81630-ACGLN
TMEM204 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81630-ANG
TMEM204 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81630-ACR
TMEM204 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81630-ANR
TMEM204 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81630-CF
TMEM204 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81630-NF
TMEM204 cDNA ORF Clone, Rat, N-His tag RG81630-NH
TMEM204 cDNA ORF Clone, Rat, C-HA tag RG81630-CY
TMEM204 cDNA ORF Clone, Rat, N-HA tag RG81630-NY
TMEM204 cDNA ORF Clone, Rat, C-Myc tag RG81630-CM
TMEM204 cDNA ORF Clone, Rat, N-Myc tag RG81630-NM

TMEM204 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TMEM204 cDNA ORF Clone in Cloning Vector, Mouse MG52512-U
TMEM204 cDNA ORF Clone, Mouse, untagged MG52512-UT
TMEM204 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52512-ACG
TMEM204 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52512-ACGLN
TMEM204 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52512-ANG
TMEM204 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52512-ACR
TMEM204 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52512-ANR
TMEM204 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52512-CF
TMEM204 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52512-NF
TMEM204 cDNA ORF Clone, Mouse, C-His tag MG52512-CH
TMEM204 cDNA ORF Clone, Mouse, N-His tag MG52512-NH
TMEM204 cDNA ORF Clone, Mouse, C-HA tag MG52512-CY
TMEM204 cDNA ORF Clone, Mouse, N-HA tag MG52512-NY
TMEM204 cDNA ORF Clone, Mouse, C-Myc tag MG52512-CM
TMEM204 cDNA ORF Clone, Mouse, N-Myc tag MG52512-NM
TMEM204 qPCR Primer Pairs, Mouse MP202385
info info
添加购物车成功! 添加购物车失败!