TAF9 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80698-NM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All TAF9 Reagents

CRO Services

Product recommended


All TAF9 Reagents

TAF9 cDNA ORF Clone, Rat, N-Myc tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
795 bp
Description
Full length Clone DNA of Rat TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TAF9 Background Information

Full Name
TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa

TAF9 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TAF9 cDNA ORF Clone in Cloning Vector, Rat RG80698-U
TAF9 cDNA ORF Clone, Rat, untagged RG80698-UT
TAF9 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80698-ACGLN
TAF9 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80698-ACG
TAF9 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80698-ANG
TAF9 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80698-ACR
TAF9 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80698-ANR
TAF9 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80698-CF
TAF9 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80698-NF
TAF9 cDNA ORF Clone, Rat, C-His tag RG80698-CH
TAF9 cDNA ORF Clone, Rat, N-His tag RG80698-NH
TAF9 cDNA ORF Clone, Rat, C-HA tag RG80698-CY
TAF9 cDNA ORF Clone, Rat, N-HA tag RG80698-NY
TAF9 cDNA ORF Clone, Rat, C-Myc tag RG80698-CM
TAF9 qPCR Primer Pairs, Rat RP300662

TAF9 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TAF9 cDNA ORF Clone in Cloning Vector, Human HG16493-G
TAF9 cDNA ORF Clone, Human, untagged HG16493-UT
TAF9 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16493-ACGLN
TAF9 cDNA ORF Clone, Human, C-GFPSpark® tag HG16493-ACG
TAF9 cDNA ORF Clone, Human, N-GFPSpark® tag HG16493-ANG
TAF9 cDNA ORF Clone, Human, C-OFPSpark® tag HG16493-ACR
TAF9 cDNA ORF Clone, Human, N-OFPSpark® tag HG16493-ANR
TAF9 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16493-CF
TAF9 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16493-NF
TAF9 cDNA ORF Clone, Human, C-His tag HG16493-CH
TAF9 cDNA ORF Clone, Human, N-His tag HG16493-NH
TAF9 cDNA ORF Clone, Human, C-HA tag HG16493-CY
TAF9 cDNA ORF Clone, Human, N-HA tag HG16493-NY
TAF9 cDNA ORF Clone, Human, C-Myc tag HG16493-CM
TAF9 cDNA ORF Clone, Human, N-Myc tag HG16493-NM
info info
添加购物车成功! 添加购物车失败!