STOML2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG81105-CF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All STOML2 Reagents

CRO Services

Product recommended


All STOML2 Reagents

STOML2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1062 bp
Description
Full length Clone DNA of Rat stomatin (Epb7.2)-like 2 with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

STOML2 Background Information

Full Name
stomatin like 2

STOML2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
STOML2 cDNA ORF Clone in Cloning Vector, Rat RG81105-U
STOML2 cDNA ORF Clone, Rat, untagged RG81105-UT
STOML2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81105-ACGLN
STOML2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81105-ACG
STOML2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81105-ANG
STOML2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81105-ACR
STOML2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81105-ANR
STOML2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81105-NF
STOML2 cDNA ORF Clone, Rat, C-His tag RG81105-CH
STOML2 cDNA ORF Clone, Rat, N-His tag RG81105-NH
STOML2 cDNA ORF Clone, Rat, C-HA tag RG81105-CY
STOML2 cDNA ORF Clone, Rat, N-HA tag RG81105-NY
STOML2 cDNA ORF Clone, Rat, C-Myc tag RG81105-CM
STOML2 cDNA ORF Clone, Rat, N-Myc tag RG81105-NM
STOML2 qPCR Primer Pairs, Rat RP301062

STOML2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
STOML2 cDNA ORF Clone in Cloning Vector, Human HG16147-G
STOML2 cDNA ORF Clone, Human, untagged HG16147-UT
STOML2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16147-ACGLN
STOML2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16147-ACG
STOML2 cDNA ORF Clone, Human, N-GFPSpark® tag HG16147-ANG
STOML2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16147-ACR
STOML2 cDNA ORF Clone, Human, N-OFPSpark® tag HG16147-ANR
STOML2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16147-CF
STOML2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16147-NF
STOML2 cDNA ORF Clone, Human, C-His tag HG16147-CH
STOML2 cDNA ORF Clone, Human, N-His tag HG16147-NH
STOML2 cDNA ORF Clone, Human, C-HA tag HG16147-CY
STOML2 cDNA ORF Clone, Human, N-HA tag HG16147-NY
STOML2 cDNA ORF Clone, Human, C-Myc tag HG16147-CM
STOML2 cDNA ORF Clone, Human, N-Myc tag HG16147-NM
STOML2 qPCR Primer Pairs, Human HP104916
info info
添加购物车成功! 添加购物车失败!