SLC25A13 cDNA ORF Clone, Rat, untagged

Cat: RG81054-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SLC25A13 Reagents
CRO Services
Product recommended

All SLC25A13 Reagents
SLC25A13 cDNA ORF Clone, Rat, untagged General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1473 bp
Description
Full length Clone DNA of Rat solute carrier family 25 (aspartate/glutamate carrier), member 13.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SLC25A13 Background Information
Full Name
solute carrier family 25 (aspartate/glutamate carrier), member 13

SLC25A13 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SLC25A13 cDNA ORF Clone in Cloning Vector, Rat RG81054-U
SLC25A13 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81054-ACGLN
SLC25A13 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81054-ACG
SLC25A13 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81054-ACR
SLC25A13 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81054-CF
SLC25A13 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81054-NF
SLC25A13 cDNA ORF Clone, Rat, C-His tag RG81054-CH
SLC25A13 cDNA ORF Clone, Rat, N-His tag RG81054-NH
SLC25A13 cDNA ORF Clone, Rat, C-HA tag RG81054-CY
SLC25A13 cDNA ORF Clone, Rat, N-HA tag RG81054-NY
SLC25A13 cDNA ORF Clone, Rat, C-Myc tag RG81054-CM
SLC25A13 cDNA ORF Clone, Rat, N-Myc tag RG81054-NM
SLC25A13 qPCR Primer Pairs, Rat RP301018

SLC25A13 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SLC25A13 cDNA ORF Clone in Cloning Vector, Mouse MG5A0024-U
SLC25A13 cDNA ORF Clone, Mouse, untagged MG5A0024-UT
SLC25A13 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0024-ACG
SLC25A13 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0024-ACGLN
SLC25A13 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A0024-ANG
SLC25A13 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A0024-ACR
SLC25A13 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A0024-ANR
SLC25A13 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A0024-CF
SLC25A13 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A0024-NF
SLC25A13 cDNA ORF Clone, Mouse, C-His tag MG5A0024-CH
SLC25A13 cDNA ORF Clone, Mouse, N-His tag MG5A0024-NH
SLC25A13 cDNA ORF Clone, Mouse, C-HA tag MG5A0024-CY
SLC25A13 cDNA ORF Clone, Mouse, N-HA tag MG5A0024-NY
SLC25A13 cDNA ORF Clone, Mouse, C-Myc tag MG5A0024-CM
SLC25A13 cDNA ORF Clone, Mouse, N-Myc tag MG5A0024-NM
info info
添加购物车成功! 添加购物车失败!