PAI-1 cDNA ORF Clone, Rat, N-HA tag

Cat: RG80442-NY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All PAI-1 Reagents

CRO Services

Product recommended


All PAI-1 Reagents

PAI-1 cDNA ORF Clone, Rat, N-HA tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1209 bp
Description
Full length Clone DNA of Rat serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PAI-1 cDNA ORF Clone, Rat, N-HA tag Alternative Names

Pai1 cDNA ORF Clone, Rat;Planh1 cDNA ORF Clone, Rat;SERPINE1 cDNA ORF Clone, Rat

PAI-1 Background Information

Plasminogen activator inhibitor 1, also known as PAI-1, Endothelial plasminogen activator inhibitor, SerpinE1 and PLANH1, is a secreted glycoprotein which belongs to the serpin family. SerpinE1 is the primary physiological inhibitor of the two plasminogen activators urokinase (uPA) and tissue plasminogen activator (tPA). Its rapid interaction with TPA may function as a major control point in the regulation of fibrinolysis. Defects in SerpinE1 are the cause of plasminogen activator inhibitor-1 deficiency (PAI-1 deficiency) which is characterized by abnormal bleeding due to SerpinE1 defect in the plasma. High concentrations of SerpinE1 have been associated with thrombophilia which is an autosomal dominant disorder in which affected individuals are prone to develop serious spontaneous thrombosis. Studies of PAI-1 have contributed significantly to the elucidation of the protease inhibitory mechanism of serpins, which is based on a metastable native state becoming stabilised by insertion of the RCL into the central beta-sheet A and formation of covalent complexes with target proteases. Greater expression of PAI-1 has been associated with increased survival of cells and resistance to apoptosis. PAI-1 appears to influence apoptosis by decreasing cell adhesion (anoikis) as well as its effect on intracellular signaling. PAI-1, in its active state, also binds to the extracellular protein vitronectin. When in complex with its target proteases, it binds with high affinity to endocytosis receptors of the low density receptor family. The mechanisms of PAI-1 overexpression during obesity are complex, and it is conceivable that several inducers are involved at the same time at several sites of synthesis. PAI-1 is also implicated in adipose tissue development. It suggests that PAI-1 inhibitors serve in the control of atherothrombosis.

Full Name
serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1
References
  • Alessi MC, et al. (2006) PAI-1 and the metabolic syndrome: links, causes, and consequences. Arterioscler Thromb Vasc Biol. 26(10): 2200-7.
  • Schneider DJ, et al. (2008) The effect of plasminogen activator inhibitor type 1 on apoptosis. Thromb Haemost. 100(6): 1037-40.
  • Dupont DM, et al. (2009) Biochemical properties of plasminogen activator inhibitor-1. Front Biosci. 14: 1337-61.
  • PAI-1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    PAI-1 cDNA ORF Clone in Cloning Vector, Rat RG80442-G
    PAI-1 cDNA ORF Clone, Rat, untagged RG80442-UT
    PAI-1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80442-ACG
    PAI-1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80442-ACGLN
    PAI-1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80442-ACR
    PAI-1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80442-CF
    PAI-1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80442-NF
    PAI-1 cDNA ORF Clone, Rat, C-His tag RG80442-CH
    PAI-1 cDNA ORF Clone, Rat, N-His tag RG80442-NH
    PAI-1 cDNA ORF Clone, Rat, C-HA tag RG80442-CY
    PAI-1 cDNA ORF Clone, Rat, C-Myc tag RG80442-CM
    PAI-1 cDNA ORF Clone, Rat, N-Myc tag RG80442-NM
    PAI-1 qPCR Primer Pairs, Rat RP300411

    PAI-1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PAI-1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57025-ACG
    PAI-1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG57025-ANG
    PAI-1 cDNA ORF Clone, Mouse, C-Myc tag MG57025-CM

    PAI-1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PAI-1 cDNA ORF Clone in Cloning Vector, Human HG10296-M
    PAI-1 cDNA ORF Clone, Human, untagged HG10296-UT
    PAI-1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10296-ACGLN
    PAI-1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10296-ACG
    PAI-1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10296-ACR
    PAI-1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10296-CF
    PAI-1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10296-NF
    PAI-1 cDNA ORF Clone, Human, C-His tag HG10296-CH
    PAI-1 cDNA ORF Clone, Human, N-His tag HG10296-NH
    PAI-1 cDNA ORF Clone, Human, C-HA tag HG10296-CY
    PAI-1 cDNA ORF Clone, Human, N-HA tag HG10296-NY
    PAI-1 cDNA ORF Clone, Human, C-Myc tag HG10296-CM
    PAI-1 cDNA ORF Clone, Human, N-Myc tag HG10296-NM
    PAI-1 qPCR Primer Pairs, Human HP100341
    info info
    添加购物车成功! 添加购物车失败!