Syndecan-1 cDNA ORF Clone, Rat, C-HA tag

Cat: RG80344-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Syndecan-1 Reagents
CRO Services
Product recommended

All Syndecan-1 Reagents
Syndecan-1 cDNA ORF Clone, Rat, C-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
942 bp
Description
Full length Clone DNA of Rat syndecan 1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Syndecan-1 Background Information

Syndecan-1 also known as SDC1 and CD138, is the most extensively studied member of the syndecan family. It is found mainly in epithelial cells, but its expression is developmentally regulated during embryonic development. Syndecan-1/SDC1/CD138 has been shown to mediate cell adhesion to several ECM molecules, and to act as a coreceptor for fibroblast growth factors, potent angiogenic growth factors involved also in differentiation. Syndecan-1/SDC1/CD138 expression is reduced during malignant transformation of various epithelia, and this loss correlates with the histological differentiation grade of squamous cell carcinomas, lacking from poorly differentiated tumours. In squamous cell carcinomas of the head and neck, positive syndecan-1 expression correlates with a more favourable prognosis. Experimental studies on the role of Syndecan-1 in malignant transformation have shown that Syndecan-1/SDC1/CD138 expression is associated with the maintenance of epithelial morphology, anchorage-dependent growth and inhibition of invasiveness in vitro.

Full Name
syndecan 1
References
  • Inki P, et al. (1996) The role of syndecan-1 in malignancies. Ann Med. 28(1): 63-7.
  • Subramanian SV, et al. (1997) Regulated shedding of syndecan-1 and -4 ectodomains by thrombin and growth factor receptor activation. J Biol Chem. 272(23): 14713-20.
  • Park PW, et al. (2001) Exploitation of syndecan-1 shedding by Pseudomonas aeruginosa enhances virulence. Nature. 411(6833): 98-102.
  • Syndecan-1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Syndecan-1 cDNA ORF Clone in Cloning Vector, Rat RG80344-G
    Syndecan-1 cDNA ORF Clone, Rat, untagged RG80344-UT
    Syndecan-1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80344-ACGLN
    Syndecan-1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80344-ACG
    Syndecan-1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80344-ACR
    Syndecan-1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80344-CF
    Syndecan-1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80344-NF
    Syndecan-1 cDNA ORF Clone, Rat, C-His tag RG80344-CH
    Syndecan-1 cDNA ORF Clone, Rat, N-His tag RG80344-NH
    Syndecan-1 cDNA ORF Clone, Rat, N-HA tag RG80344-NY
    Syndecan-1 cDNA ORF Clone, Rat, C-Myc tag RG80344-CM
    Syndecan-1 cDNA ORF Clone, Rat, N-Myc tag RG80344-NM
    Syndecan-1 qPCR Primer Pairs, Rat RP300314

    Syndecan-1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Syndecan-1 cDNA ORF Clone in Cloning Vector, Mouse MG50641-M
    Syndecan-1 cDNA ORF Clone, Mouse, untagged MG50641-UT
    Syndecan-1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50641-ACG
    Syndecan-1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50641-ACGLN
    Syndecan-1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50641-ACR
    Syndecan-1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50641-CF
    Syndecan-1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50641-NF
    Syndecan-1 cDNA ORF Clone, Mouse, C-His tag MG50641-CH
    Syndecan-1 cDNA ORF Clone, Mouse, N-His tag MG50641-NH
    Syndecan-1 cDNA ORF Clone, Mouse, C-HA tag MG50641-CY
    Syndecan-1 cDNA ORF Clone, Mouse, N-HA tag MG50641-NY
    Syndecan-1 cDNA ORF Clone, Mouse, C-Myc tag MG50641-CM
    Syndecan-1 cDNA ORF Clone, Mouse, N-Myc tag MG50641-NM
    Syndecan-1 qPCR Primer Pairs, Mouse MP200621

    Syndecan-1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Syndecan-1 cDNA ORF Clone in Cloning Vector, Human HG11429-U
    Syndecan-1 cDNA ORF Clone, Human, untagged HG11429-UT
    Syndecan-1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11429-ACGLN
    Syndecan-1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11429-ACG
    Syndecan-1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11429-ACR
    Syndecan-1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11429-CF
    Syndecan-1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11429-NF
    Syndecan-1 cDNA ORF Clone, Human, C-His tag HG11429-CH
    Syndecan-1 cDNA ORF Clone, Human, N-His tag HG11429-NH
    Syndecan-1 cDNA ORF Clone, Human, C-HA tag HG11429-CY
    Syndecan-1 cDNA ORF Clone, Human, N-HA tag HG11429-NY
    Syndecan-1 cDNA ORF Clone, Human, C-Myc tag HG11429-CM
    Syndecan-1 cDNA ORF Clone, Human, N-Myc tag HG11429-NM
    Syndecan-1 qPCR Primer Pairs, Human HP101306
    info info
    添加购物车成功! 添加购物车失败!