SC5D cDNA ORF Clone, Rat, untagged

Cat: RG81042-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SC5D Reagents
CRO Services
Product recommended

All SC5D Reagents
SC5D cDNA ORF Clone, Rat, untagged General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
900 bp
Description
Full length Clone DNA of Rat sterol-C5-desaturase.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SC5D Background Information
Full Name
sterol-C5-desaturase

SC5D cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SC5D cDNA ORF Clone in Cloning Vector, Rat RG81042-U
SC5D Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81042-ACGLN
SC5D cDNA ORF Clone, Rat, C-GFPSpark® tag RG81042-ACG
SC5D cDNA ORF Clone, Rat, C-OFPSpark® tag RG81042-ACR
SC5D cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81042-CF
SC5D cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81042-NF
SC5D cDNA ORF Clone, Rat, C-His tag RG81042-CH
SC5D cDNA ORF Clone, Rat, N-His tag RG81042-NH
SC5D cDNA ORF Clone, Rat, C-HA tag RG81042-CY
SC5D cDNA ORF Clone, Rat, N-HA tag RG81042-NY
SC5D cDNA ORF Clone, Rat, C-Myc tag RG81042-CM
SC5D cDNA ORF Clone, Rat, N-Myc tag RG81042-NM
SC5D qPCR Primer Pairs, Rat RP301006

SC5D cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SC5D cDNA ORF Clone in Cloning Vector, Mouse MG52185-G
SC5D cDNA ORF Clone, Mouse, untagged MG52185-UT
SC5D Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52185-ACGLN
SC5D cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52185-ACG
SC5D cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52185-ANG
SC5D cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52185-ACR
SC5D cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52185-ANR
SC5D cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52185-CF
SC5D cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52185-NF
SC5D cDNA ORF Clone, Mouse, C-His tag MG52185-CH
SC5D cDNA ORF Clone, Mouse, N-His tag MG52185-NH
SC5D cDNA ORF Clone, Mouse, C-HA tag MG52185-CY
SC5D cDNA ORF Clone, Mouse, N-HA tag MG52185-NY
SC5D cDNA ORF Clone, Mouse, C-Myc tag MG52185-CM
SC5D cDNA ORF Clone, Mouse, N-Myc tag MG52185-NM
SC5D qPCR Primer Pairs, Mouse MP202058

SC5D cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SC5D cDNA ORF Clone in Cloning Vector, Human HG16672-U
SC5D cDNA ORF Clone, Human, untagged HG16672-UT
SC5D cDNA ORF Clone, Human, C-GFPSpark® tag HG16672-ACG
SC5D Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16672-ACGLN
SC5D cDNA ORF Clone, Human, C-OFPSpark® tag HG16672-ACR
SC5D cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16672-CF
SC5D cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16672-NF
SC5D cDNA ORF Clone, Human, C-His tag HG16672-CH
SC5D cDNA ORF Clone, Human, N-His tag HG16672-NH
SC5D cDNA ORF Clone, Human, C-HA tag HG16672-CY
SC5D cDNA ORF Clone, Human, N-HA tag HG16672-NY
SC5D cDNA ORF Clone, Human, C-Myc tag HG16672-CM
SC5D cDNA ORF Clone, Human, N-Myc tag HG16672-NM
info info
添加购物车成功! 添加购物车失败!