RTN1 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80697-NM

This product is not available, please contact order@sinobiological.com for relevant product if required.

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All RTN1 Reagents

CRO Services


All RTN1 Reagents

RTN1 cDNA ORF Clone, Rat, N-Myc tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
627 bp
Description
Full length Clone DNA of Rat reticulon 1 with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RTN1 cDNA ORF Clone, Rat, N-Myc tag Alternative Names

Nsp cDNA ORF Clone, Rat

RTN1 Background Information

Full Name
reticulon 1

RTN1 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
RTN1 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90367-G
RTN1 cDNA ORF Clone, Cynomolgus, untagged CG90367-UT
RTN1 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90367-ACGLN
RTN1 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90367-ACG
RTN1 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90367-ANG
RTN1 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90367-ACR
RTN1 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90367-ANR
RTN1 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90367-CF
RTN1 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90367-NF
RTN1 cDNA ORF Clone, Cynomolgus, C-His tag CG90367-CH
RTN1 cDNA ORF Clone, Cynomolgus, N-His tag CG90367-NH
RTN1 cDNA ORF Clone, Cynomolgus, C-HA tag CG90367-CY
RTN1 cDNA ORF Clone, Cynomolgus, N-HA tag CG90367-NY
RTN1 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90367-CM
RTN1 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90367-NM

RTN1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RTN1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A6962-ACG
RTN1 qPCR Primer Pairs, Rat RP300661

RTN1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RTN1 cDNA ORF Clone in Cloning Vector, Mouse MG51495-U
RTN1 cDNA ORF Clone, Mouse, untagged MG51495-UT
RTN1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51495-ACG
RTN1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51495-ACGLN
RTN1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51495-ANG
RTN1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51495-ACR
RTN1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51495-ANR
RTN1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51495-CF
RTN1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51495-NF
RTN1 cDNA ORF Clone, Mouse, C-His tag MG51495-CH
RTN1 cDNA ORF Clone, Mouse, N-His tag MG51495-NH
RTN1 cDNA ORF Clone, Mouse, C-HA tag MG51495-CY
RTN1 cDNA ORF Clone, Mouse, N-HA tag MG51495-NY
RTN1 cDNA ORF Clone, Mouse, C-Myc tag MG51495-CM
RTN1 cDNA ORF Clone, Mouse, N-Myc tag MG51495-NM
RTN1 qPCR Primer Pairs, Mouse MP201379

RTN1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RTN1 cDNA ORF Clone in Cloning Vector, Human HG18936-U
info info
添加购物车成功! 添加购物车失败!