PSMC3 cDNA ORF Clone, Rat, untagged

Cat: RG81004-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PSMC3 Reagents
CRO Services
Product recommended

All PSMC3 Reagents
PSMC3 cDNA ORF Clone, Rat, untagged General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1329 bp
Description
Full length Clone DNA of Rat proteasome (prosome, macropain) 26S subunit, ATPase 3.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PSMC3 Background Information
Full Name
proteasome (prosome, macropain) 26S subunit, ATPase, 3

PSMC3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PSMC3 cDNA ORF Clone in Cloning Vector, Rat RG81004-U
PSMC3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81004-ACGLN
PSMC3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81004-ACG
PSMC3 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81004-ANG
PSMC3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81004-ACR
PSMC3 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81004-ANR
PSMC3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81004-CF
PSMC3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81004-NF
PSMC3 cDNA ORF Clone, Rat, C-His tag RG81004-CH
PSMC3 cDNA ORF Clone, Rat, N-His tag RG81004-NH
PSMC3 cDNA ORF Clone, Rat, C-HA tag RG81004-CY
PSMC3 cDNA ORF Clone, Rat, N-HA tag RG81004-NY
PSMC3 cDNA ORF Clone, Rat, C-Myc tag RG81004-CM
PSMC3 cDNA ORF Clone, Rat, N-Myc tag RG81004-NM
PSMC3 qPCR Primer Pairs, Rat RP300968

PSMC3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PSMC3 cDNA ORF Clone in Cloning Vector, Mouse MG51701-G
PSMC3 cDNA ORF Clone, Mouse, untagged MG51701-UT
PSMC3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51701-ACG
PSMC3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51701-ACGLN
PSMC3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51701-ANG
PSMC3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51701-ACR
PSMC3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51701-ANR
PSMC3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51701-CF
PSMC3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51701-NF
PSMC3 cDNA ORF Clone, Mouse, C-His tag MG51701-CH
PSMC3 cDNA ORF Clone, Mouse, N-His tag MG51701-NH
PSMC3 cDNA ORF Clone, Mouse, C-HA tag MG51701-CY
PSMC3 cDNA ORF Clone, Mouse, N-HA tag MG51701-NY
PSMC3 cDNA ORF Clone, Mouse, C-Myc tag MG51701-CM
PSMC3 cDNA ORF Clone, Mouse, N-Myc tag MG51701-NM
PSMC3 qPCR Primer Pairs, Mouse MP201574

PSMC3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PSMC3 cDNA ORF Clone in Cloning Vector, Human HG15736-G
PSMC3 cDNA ORF Clone, Human, untagged HG15736-UT
PSMC3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15736-ACGLN
PSMC3 cDNA ORF Clone, Human, C-GFPSpark® tag HG15736-ACG
PSMC3 cDNA ORF Clone, Human, N-GFPSpark® tag HG15736-ANG
PSMC3 cDNA ORF Clone, Human, C-OFPSpark® tag HG15736-ACR
PSMC3 cDNA ORF Clone, Human, N-OFPSpark® tag HG15736-ANR
PSMC3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15736-CF
PSMC3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15736-NF
PSMC3 cDNA ORF Clone, Human, C-His tag HG15736-CH
PSMC3 cDNA ORF Clone, Human, N-His tag HG15736-NH
PSMC3 cDNA ORF Clone, Human, C-HA tag HG15736-CY
PSMC3 cDNA ORF Clone, Human, N-HA tag HG15736-NY
PSMC3 cDNA ORF Clone, Human, C-Myc tag HG15736-CM
PSMC3 cDNA ORF Clone, Human, N-Myc tag HG15736-NM
PSMC3 qPCR Primer Pairs, Human HP104329
info info
添加购物车成功! 添加购物车失败!