Cyclophilin B cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80725-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Cyclophilin B Reagents
CRO Services
Product recommended

All Cyclophilin B Reagents
Cyclophilin B cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
627 bp
Description
Full length Clone DNA of Rat peptidylprolyl isomerase B with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cyclophilin B Background Information
Full Name
peptidylprolyl isomerase B (cyclophilin B)

Cyclophilin B cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Cyclophilin B cDNA ORF Clone in Cloning Vector, Rat RG80725-U
Cyclophilin B cDNA ORF Clone, Rat, untagged RG80725-UT
Cyclophilin B Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80725-ACGLN
Cyclophilin B cDNA ORF Clone, Rat, C-GFPSpark® tag RG80725-ACG
Cyclophilin B cDNA ORF Clone, Rat, C-OFPSpark® tag RG80725-ACR
Cyclophilin B cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80725-CF
Cyclophilin B cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80725-NF
Cyclophilin B cDNA ORF Clone, Rat, C-His tag RG80725-CH
Cyclophilin B cDNA ORF Clone, Rat, N-His tag RG80725-NH
Cyclophilin B cDNA ORF Clone, Rat, C-HA tag RG80725-CY
Cyclophilin B cDNA ORF Clone, Rat, N-HA tag RG80725-NY
Cyclophilin B cDNA ORF Clone, Rat, C-Myc tag RG80725-CM
Cyclophilin B qPCR Primer Pairs, Rat RP300689

Cyclophilin B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Cyclophilin B cDNA ORF Clone in Cloning Vector, Mouse MG50294-M
Cyclophilin B cDNA ORF Clone, Mouse, untagged MG50294-UT
Cyclophilin B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50294-ACG
Cyclophilin B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50294-ACGLN
Cyclophilin B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50294-ACR
Cyclophilin B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50294-CF
Cyclophilin B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50294-NF
Cyclophilin B cDNA ORF Clone, Mouse, C-His tag MG50294-CH
Cyclophilin B cDNA ORF Clone, Mouse, N-His tag MG50294-NH
Cyclophilin B cDNA ORF Clone, Mouse, C-HA tag MG50294-CY
Cyclophilin B cDNA ORF Clone, Mouse, N-HA tag MG50294-NY
Cyclophilin B cDNA ORF Clone, Mouse, C-Myc tag MG50294-CM
Cyclophilin B cDNA ORF Clone, Mouse, N-Myc tag MG50294-NM
Cyclophilin B qPCR Primer Pairs, Mouse MP200318

Cyclophilin B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Cyclophilin B cDNA ORF Clone in Cloning Vector, Human HG11004-M
Cyclophilin B cDNA ORF Clone, Human, untagged HG11004-UT
Cyclophilin B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11004-ACGLN
Cyclophilin B cDNA ORF Clone, Human, C-GFPSpark® tag HG11004-ACG
Cyclophilin B cDNA ORF Clone, Human, C-OFPSpark® tag HG11004-ACR
Cyclophilin B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11004-CF
Cyclophilin B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11004-NF
Cyclophilin B cDNA ORF Clone, Human, C-His tag HG11004-CH
Cyclophilin B cDNA ORF Clone, Human, N-His tag HG11004-NH
Cyclophilin B cDNA ORF Clone, Human, C-HA tag HG11004-CY
Cyclophilin B cDNA ORF Clone, Human, N-HA tag HG11004-NY
Cyclophilin B cDNA ORF Clone, Human, C-Myc tag HG11004-CM
Cyclophilin B cDNA ORF Clone, Human, N-Myc tag HG11004-NM
Cyclophilin B qPCR Primer Pairs, Human HP100966
info info
添加购物车成功! 添加购物车失败!