PARK7 / DJ-1 cDNA ORF Clone, Rat, N-HA tag

Cat: RG80500-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PARK7 / DJ-1 Reagents
CRO Services
Product recommended

All PARK7 / DJ-1 Reagents
PARK7 / DJ-1 cDNA ORF Clone, Rat, N-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
570 bp
Description
Full length Clone DNA of Rat parkinson protein 7 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PARK7 / DJ-1 Background Information

Parkinson's disease locus DJ-1 (PARK7) is a differentially expressed transcript. DJ-1 plays a physiologic role in protection of erythroid cells from oxidant damage, a function unmasked in the context of oxidative stress. PARK7 belongs to the peptidase C56 family of proteins. It acts as a positive regulator of androgen receptor-dependent transcription. It may also function as a redox-sensitive chaperone, as a sensor for oxidative stress, and it apparently protects neurons against oxidative stress and cell death. Mutations in the DJ-1 gene are associated with rare forms of autosomal recessive early-onset Parkinson's disease (PD). DJ-1/p53 interactions contribute to apoptosis resistance in clonal myeloid cells and may serve as a prognostic marker in patients with myelodysplastic syndromes (MDS). DJ-1 regulates redox signaling kinase pathways and acts as a transcriptional regulator of antioxidative gene batteries. Therefore, DJ-1 is an important redox-reactive signaling intermediate controlling oxidative stress after ischemia, upon neuroinflammation, and during age-related neurodegenerative processes. Augmenting DJ-1 activity might provide novel approaches to treating chronic neurodegenerative illnesses such as Parkinson's disease and acute damage such as stroke.

Full Name
parkinson protein 7
References
  • Takahashi K, et al. (2001). DJ-1 positively regulates the androgen receptor by impairing the binding of PIASx alpha to the receptor. J. Biol. Chem. (United States). 276 (40): 37556-63.
  • Niki, Takeshi, et al. (2003). DJBP: a novel DJ-1-binding protein, negatively regulates the androgen receptor by recruiting histone deacetylase complex, and DJ-1 antagonizes this inhibition by abrogation of this complex. Mol. Cancer Res. (United States). 1 (4): 247-61.
  • Kahle PJ, et al. (2009) DJ-1 and prevention of oxidative stress in Parkinson's disease and other age-related disorders. Free Radic Biol Med. 47(10): 1354-61.
  • Xu X, et al. (2010) The familial Parkinson's disease gene DJ-1 (PARK7) is expressed in red cells and plays a role in protection against oxidative damage. Blood Cells Mol Dis. 45(3): 227-32.
  • Marcondes AM, et al. (2010) Identification of DJ-1/PARK-7 as a determinant of stroma-dependent and TNF-alpha-induced apoptosis in MDS using mass spectrometry and phosphopeptide analysis. Blood. 115(10): 1993-2002.
  • PARK7 / DJ-1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    PARK7 / DJ-1 cDNA ORF Clone in Cloning Vector, Rat RG80500-U
    PARK7 / DJ-1 cDNA ORF Clone, Rat, untagged RG80500-UT
    PARK7 / DJ-1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80500-ACGLN
    PARK7 / DJ-1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80500-ACG
    PARK7 / DJ-1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80500-ANG
    PARK7 / DJ-1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80500-ACR
    PARK7 / DJ-1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80500-ANR
    PARK7 / DJ-1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80500-CF
    PARK7 / DJ-1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80500-NF
    PARK7 / DJ-1 cDNA ORF Clone, Rat, C-His tag RG80500-CH
    PARK7 / DJ-1 cDNA ORF Clone, Rat, N-His tag RG80500-NH
    PARK7 / DJ-1 cDNA ORF Clone, Rat, C-HA tag RG80500-CY
    PARK7 / DJ-1 cDNA ORF Clone, Rat, C-Myc tag RG80500-CM
    PARK7 / DJ-1 cDNA ORF Clone, Rat, N-Myc tag RG80500-NM
    PARK7 / DJ-1 qPCR Primer Pairs, Rat RP300464

    PARK7 / DJ-1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PARK7 / DJ-1 cDNA ORF Clone in Cloning Vector, Mouse MG52768-G
    PARK7 / DJ-1 cDNA ORF Clone, Mouse, untagged MG52768-UT
    PARK7 / DJ-1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52768-ACGLN
    PARK7 / DJ-1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52768-ACG
    PARK7 / DJ-1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52768-ANG
    PARK7 / DJ-1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52768-ACR
    PARK7 / DJ-1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52768-ANR
    PARK7 / DJ-1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52768-CF
    PARK7 / DJ-1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52768-NF
    PARK7 / DJ-1 cDNA ORF Clone, Mouse, C-His tag MG52768-CH
    PARK7 / DJ-1 cDNA ORF Clone, Mouse, N-His tag MG52768-NH
    PARK7 / DJ-1 cDNA ORF Clone, Mouse, C-HA tag MG52768-CY
    PARK7 / DJ-1 cDNA ORF Clone, Mouse, N-HA tag MG52768-NY
    PARK7 / DJ-1 cDNA ORF Clone, Mouse, C-Myc tag MG52768-CM
    PARK7 / DJ-1 cDNA ORF Clone, Mouse, N-Myc tag MG52768-NM

    PARK7 / DJ-1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PARK7 / DJ-1 cDNA ORF Clone in Cloning Vector, Human HG16199-G
    PARK7 / DJ-1 cDNA ORF Clone, Human, untagged HG12484-UT
    PARK7 / DJ-1 cDNA ORF Clone, Human, untagged HG16199-UT
    PARK7 / DJ-1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12484-ACGLN
    PARK7 / DJ-1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16199-ACG
    PARK7 / DJ-1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16199-ACGLN
    PARK7 / DJ-1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16199-ANG
    PARK7 / DJ-1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16199-ACR
    PARK7 / DJ-1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16199-ANR
    PARK7 / DJ-1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16199-CF
    PARK7 / DJ-1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16199-NF
    PARK7 / DJ-1 cDNA ORF Clone, Human, C-His tag HG16199-CH
    PARK7 / DJ-1 cDNA ORF Clone, Human, N-His tag HG16199-NH
    PARK7 / DJ-1 cDNA ORF Clone, Human, C-HA tag HG16199-CY
    PARK7 / DJ-1 cDNA ORF Clone, Human, N-HA tag HG16199-NY
    PARK7 / DJ-1 cDNA ORF Clone, Human, C-Myc tag HG16199-CM
    PARK7 / DJ-1 cDNA ORF Clone, Human, N-Myc tag HG16199-NM
    PARK7 / DJ-1 qPCR Primer Pairs, Human HP104810
    info info
    添加购物车成功! 添加购物车失败!