NUCB1/Nucleobindin 1 cDNA ORF Clone, Rat, C-His tag

Cat: RG81041-CH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All NUCB1/Nucleobindin 1 Reagents

CRO Services

Product recommended


All NUCB1/Nucleobindin 1 Reagents

NUCB1/Nucleobindin 1 cDNA ORF Clone, Rat, C-His tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1380 bp
Description
Full length Clone DNA of Rat nucleobindin 1 with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NUCB1/Nucleobindin 1 Background Information

Full Name
nucleobindin 1

NUCB1/Nucleobindin 1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
NUCB1/Nucleobindin 1 cDNA ORF Clone in Cloning Vector, Rat RG81041-U
NUCB1/Nucleobindin 1 cDNA ORF Clone, Rat, untagged RG81041-UT
NUCB1/Nucleobindin 1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81041-ACG
NUCB1/Nucleobindin 1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81041-ACGLN
NUCB1/Nucleobindin 1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81041-ACR
NUCB1/Nucleobindin 1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81041-CF
NUCB1/Nucleobindin 1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81041-NF
NUCB1/Nucleobindin 1 cDNA ORF Clone, Rat, N-His tag RG81041-NH
NUCB1/Nucleobindin 1 cDNA ORF Clone, Rat, C-HA tag RG81041-CY
NUCB1/Nucleobindin 1 cDNA ORF Clone, Rat, N-HA tag RG81041-NY
NUCB1/Nucleobindin 1 cDNA ORF Clone, Rat, C-Myc tag RG81041-CM
NUCB1/Nucleobindin 1 cDNA ORF Clone, Rat, N-Myc tag RG81041-NM
NUCB1/Nucleobindin 1 qPCR Primer Pairs, Rat RP301005

NUCB1/Nucleobindin 1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NUCB1/Nucleobindin 1 cDNA ORF Clone in Cloning Vector, Mouse MG51633-U
NUCB1/Nucleobindin 1 cDNA ORF Clone, Mouse, untagged MG51633-UT
NUCB1/Nucleobindin 1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51633-ACGLN
NUCB1/Nucleobindin 1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51633-ACG
NUCB1/Nucleobindin 1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51633-ACR
NUCB1/Nucleobindin 1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51633-CF
NUCB1/Nucleobindin 1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51633-NF
NUCB1/Nucleobindin 1 cDNA ORF Clone, Mouse, C-His tag MG51633-CH
NUCB1/Nucleobindin 1 cDNA ORF Clone, Mouse, N-His tag MG51633-NH
NUCB1/Nucleobindin 1 cDNA ORF Clone, Mouse, C-HA tag MG51633-CY
NUCB1/Nucleobindin 1 cDNA ORF Clone, Mouse, N-HA tag MG51633-NY
NUCB1/Nucleobindin 1 cDNA ORF Clone, Mouse, C-Myc tag MG51633-CM
NUCB1/Nucleobindin 1 cDNA ORF Clone, Mouse, N-Myc tag MG51633-NM
NUCB1/Nucleobindin 1 qPCR Primer Pairs, Mouse MP201506

NUCB1/Nucleobindin 1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NUCB1/Nucleobindin 1 cDNA ORF Clone, Human, untagged HG19539-UT
info info
添加购物车成功! 添加购物车失败!