CD73 cDNA ORF Clone, Rat, N-His tag

Cat: RG80335-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CD73 Reagents
CRO Services
Product recommended

All CD73 Reagents
CD73 cDNA ORF Clone, Rat, N-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1731 bp
Description
Full length Clone DNA of Rat 5' nucleotidase, ecto with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD73 Background Information

5'-nucleotidase, also known as NT5E, NTE, and CD73, is a cell membrane protein which belongs to the 5'-nucleotidase family. CD73 is a glycosyl phosphatidylinositol (GPI) anchored purine salvage enzyme expressed on the surface of human T and B lymphocytes. CD73 catalyzes the conversion of purine and pyrimidine ribo- and deoxyribonucleoside monophosphates to the corresponding nucleosides. CD73 serves as a costimulatory molecule in activating T cells. CD73 generated adenosine functions in cell signalling in many physiologic systems, including intestinal epithelium, ischemic myocardium, and cholinergic synapses. CD73 might mediate lymphocyte-stromal cell interactions or condition the local microenvironment to facilitate lymphocyte development and/or function. In CD73-depleted cells, surface levels of the leukocyte adhesion molecules ICAM-1, VCAM-1 and E-selectin increase. CD73 produces extracellular adenosine, which then acts on G protein-coupled purigenic receptors to induce cellular responses. CD73 has also been reported to regulate expression of pro-inflammatory molecules in mouse endothelium.

Full Name
5'-nucleotidase, ecto (CD73)
References
  • Resta R. et al., 1997, Cell Signal. 9 (2): 131-9.
  • Yamashita Y. et al., 1998, Eur J Immunol. 28 (10): 2981-90.
  • Louis NA. et al., 2008, J Immunol. 180 (6): 4246-55.
  • Grünewald JK. et al., 2010, J Inflamm. 7 (1): 10.
  • CD73 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    CD73 cDNA ORF Clone in Cloning Vector, Rhesus CG90192-G
    CD73 cDNA ORF Clone, Rhesus, untagged CG90192-UT
    CD73 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90192-ACGLN
    CD73 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90192-ACG
    CD73 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90192-ACR
    CD73 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90192-CF
    CD73 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90192-NF
    CD73 cDNA ORF Clone, Rhesus, C-His tag CG90192-CH
    CD73 cDNA ORF Clone, Rhesus, N-His tag CG90192-NH
    CD73 cDNA ORF Clone, Rhesus, C-HA tag CG90192-CY
    CD73 cDNA ORF Clone, Rhesus, N-HA tag CG90192-NY
    CD73 cDNA ORF Clone, Rhesus, C-Myc tag CG90192-CM
    CD73 cDNA ORF Clone, Rhesus, N-Myc tag CG90192-NM

    CD73 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD73 cDNA ORF Clone in Cloning Vector, Rat RG80335-G
    CD73 cDNA ORF Clone, Rat, untagged RG80335-UT
    CD73 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80335-ACGLN
    CD73 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80335-ACG
    CD73 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80335-ACR
    CD73 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80335-CF
    CD73 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80335-NF
    CD73 cDNA ORF Clone, Rat, C-His tag RG80335-CH
    CD73 cDNA ORF Clone, Rat, C-HA tag RG80335-CY
    CD73 cDNA ORF Clone, Rat, N-HA tag RG80335-NY
    CD73 cDNA ORF Clone, Rat, C-Myc tag RG80335-CM
    CD73 cDNA ORF Clone, Rat, N-Myc tag RG80335-NM
    CD73 qPCR Primer Pairs, Rat RP300305

    CD73 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD73 cDNA ORF Clone in Cloning Vector, Mouse MG50231-M
    CD73 cDNA ORF Clone, Mouse, untagged MG50231-UT
    CD73 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50231-ACGLN
    CD73 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50231-ACG
    CD73 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50231-ACR
    CD73 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50231-CF
    CD73 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50231-NF
    CD73 cDNA ORF Clone, Mouse, C-His tag MG50231-CH
    CD73 cDNA ORF Clone, Mouse, N-His tag MG50231-NH
    CD73 cDNA ORF Clone, Mouse, C-HA tag MG50231-CY
    CD73 cDNA ORF Clone, Mouse, N-HA tag MG50231-NY
    CD73 cDNA ORF Clone, Mouse, C-Myc tag MG50231-CM
    CD73 cDNA ORF Clone, Mouse, N-Myc tag MG50231-NM
    CD73 qPCR Primer Pairs, Mouse MP200258

    CD73 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD73 cDNA ORF Clone in Cloning Vector, Human HG10904-G
    CD73 cDNA ORF Clone, Human, untagged HG10904-UT
    CD73 cDNA ORF Clone, Human, C-GFPSpark® tag HG10904-ACG
    CD73 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10904-ACGLN
    CD73 cDNA ORF Clone, Human, C-OFPSpark® tag HG10904-ACR
    CD73 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10904-CF
    CD73 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10904-NF
    CD73 cDNA ORF Clone, Human, C-His tag HG10904-CH
    CD73 cDNA ORF Clone, Human, N-His tag HG10904-NH
    CD73 cDNA ORF Clone, Human, C-HA tag HG10904-CY
    CD73 cDNA ORF Clone, Human, N-HA tag HG10904-NY
    CD73 cDNA ORF Clone, Human, C-Myc tag HG10904-CM
    CD73 cDNA ORF Clone, Human, N-Myc tag HG10904-NM
    CD73 qPCR Primer Pairs, Human HP100788
    info info
    添加购物车成功! 添加购物车失败!