MYOT/Myotilin cDNA ORF Clone, Rat, C-His tag

Cat: RG81047-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MYOT/Myotilin Reagents
CRO Services
Product recommended

All MYOT/Myotilin Reagents
MYOT/Myotilin cDNA ORF Clone, Rat, C-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1491 bp
Description
Full length Clone DNA of Rat myotilin with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MYOT/Myotilin cDNA ORF Clone, Rat, C-His tag Alternative Names
Ttid cDNA ORF Clone, Rat
MYOT/Myotilin Background Information
Full Name
myotilin

MYOT/Myotilin cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MYOT/Myotilin cDNA ORF Clone in Cloning Vector, Rat RG81047-U
MYOT/Myotilin cDNA ORF Clone, Rat, untagged RG81047-UT
MYOT/Myotilin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81047-ACGLN
MYOT/Myotilin cDNA ORF Clone, Rat, C-GFPSpark® tag RG81047-ACG
MYOT/Myotilin cDNA ORF Clone, Rat, N-GFPSpark® tag RG81047-ANG
MYOT/Myotilin cDNA ORF Clone, Rat, C-OFPSpark® tag RG81047-ACR
MYOT/Myotilin cDNA ORF Clone, Rat, N-OFPSpark® tag RG81047-ANR
MYOT/Myotilin cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81047-CF
MYOT/Myotilin cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81047-NF
MYOT/Myotilin cDNA ORF Clone, Rat, N-His tag RG81047-NH
MYOT/Myotilin cDNA ORF Clone, Rat, C-HA tag RG81047-CY
MYOT/Myotilin cDNA ORF Clone, Rat, N-HA tag RG81047-NY
MYOT/Myotilin cDNA ORF Clone, Rat, C-Myc tag RG81047-CM
MYOT/Myotilin cDNA ORF Clone, Rat, N-Myc tag RG81047-NM
MYOT/Myotilin qPCR Primer Pairs, Rat RP301011

MYOT/Myotilin cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MYOT/Myotilin cDNA ORF Clone in Cloning Vector, Mouse MG5A0730-U
MYOT/Myotilin cDNA ORF Clone, Mouse, untagged MG5A0730-UT
MYOT/Myotilin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0730-ACGLN
MYOT/Myotilin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0730-ACG
MYOT/Myotilin cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A0730-ANG
MYOT/Myotilin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A0730-ACR
MYOT/Myotilin cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A0730-ANR
MYOT/Myotilin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A0730-CF
MYOT/Myotilin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A0730-NF
MYOT/Myotilin cDNA ORF Clone, Mouse, C-His tag MG5A0730-CH
MYOT/Myotilin cDNA ORF Clone, Mouse, N-His tag MG5A0730-NH
MYOT/Myotilin cDNA ORF Clone, Mouse, C-HA tag MG5A0730-CY
MYOT/Myotilin cDNA ORF Clone, Mouse, N-HA tag MG5A0730-NY
MYOT/Myotilin cDNA ORF Clone, Mouse, C-Myc tag MG5A0730-CM
MYOT/Myotilin cDNA ORF Clone, Mouse, N-Myc tag MG5A0730-NM

MYOT/Myotilin cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MYOT/Myotilin cDNA ORF Clone in Cloning Vector, Human HG14469-G
MYOT/Myotilin cDNA ORF Clone, Human, untagged HG14469-UT
MYOT/Myotilin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14469-ACGLN
MYOT/Myotilin cDNA ORF Clone, Human, C-GFPSpark® tag HG14469-ACG
MYOT/Myotilin cDNA ORF Clone, Human, N-GFPSpark® tag HG14469-ANG
MYOT/Myotilin cDNA ORF Clone, Human, C-OFPSpark® tag HG14469-ACR
MYOT/Myotilin cDNA ORF Clone, Human, N-OFPSpark® tag HG14469-ANR
MYOT/Myotilin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14469-CF
MYOT/Myotilin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14469-NF
MYOT/Myotilin cDNA ORF Clone, Human, C-His tag HG14469-CH
MYOT/Myotilin cDNA ORF Clone, Human, N-His tag HG14469-NH
MYOT/Myotilin cDNA ORF Clone, Human, C-HA tag HG14469-CY
MYOT/Myotilin cDNA ORF Clone, Human, N-HA tag HG14469-NY
MYOT/Myotilin cDNA ORF Clone, Human, C-Myc tag HG14469-CM
MYOT/Myotilin cDNA ORF Clone, Human, N-Myc tag HG14469-NM
MYOT/Myotilin qPCR Primer Pairs, Human HP103117
info info
添加购物车成功! 添加购物车失败!