MYLPF cDNA ORF Clone, Rat, N-HA tag

Cat: RG80498-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MYLPF Reagents
CRO Services
Product recommended

All MYLPF Reagents
MYLPF cDNA ORF Clone, Rat, N-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
510 bp
Description
Full length Clone DNA of Rat myosin light chain, phosphorylatable, fast skeletal muscle with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MYLPF Background Information
Full Name
myosin light chain, phosphorylatable, fast skeletal muscle

MYLPF cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MYLPF cDNA ORF Clone in Cloning Vector, Rat RG80498-U
MYLPF cDNA ORF Clone, Rat, untagged RG80498-UT
MYLPF Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80498-ACGLN
MYLPF cDNA ORF Clone, Rat, C-GFPSpark® tag RG80498-ACG
MYLPF cDNA ORF Clone, Rat, N-GFPSpark® tag RG80498-ANG
MYLPF cDNA ORF Clone, Rat, C-OFPSpark® tag RG80498-ACR
MYLPF cDNA ORF Clone, Rat, N-OFPSpark® tag RG80498-ANR
MYLPF cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80498-CF
MYLPF cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80498-NF
MYLPF cDNA ORF Clone, Rat, C-His tag RG80498-CH
MYLPF cDNA ORF Clone, Rat, N-His tag RG80498-NH
MYLPF cDNA ORF Clone, Rat, C-HA tag RG80498-CY
MYLPF cDNA ORF Clone, Rat, C-Myc tag RG80498-CM
MYLPF cDNA ORF Clone, Rat, N-Myc tag RG80498-NM
MYLPF qPCR Primer Pairs, Rat RP300462

MYLPF cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MYLPF cDNA ORF Clone in Cloning Vector, Mouse MG53407-U
MYLPF cDNA ORF Clone, Mouse, untagged MG53407-UT
MYLPF Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53407-ACGLN
MYLPF cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53407-ACG
MYLPF cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53407-ANG
MYLPF cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53407-ACR
MYLPF cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53407-ANR
MYLPF cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53407-CF
MYLPF cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53407-NF
MYLPF cDNA ORF Clone, Mouse, C-His tag MG53407-CH
MYLPF cDNA ORF Clone, Mouse, N-His tag MG53407-NH
MYLPF cDNA ORF Clone, Mouse, C-HA tag MG53407-CY
MYLPF cDNA ORF Clone, Mouse, N-HA tag MG53407-NY
MYLPF cDNA ORF Clone, Mouse, C-Myc tag MG53407-CM
MYLPF cDNA ORF Clone, Mouse, N-Myc tag MG53407-NM

MYLPF cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MYLPF cDNA ORF Clone in Cloning Vector, Human HG24901-U
info info
添加购物车成功! 添加购物车失败!