RORC cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Cat: RG81609-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RORC Reagents
CRO Services
Product recommended

All RORC Reagents
RORC cDNA ORF Clone, Rat, N-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1617 bp
Description
Full length Clone DNA of Rat RAR-related orphan receptor C with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RORC Background Information
Full Name
RAR-related orphan receptor C

RORC cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RORC cDNA ORF Clone in Cloning Vector, Rat RG81609-G
RORC cDNA ORF Clone, Rat, untagged RG81609-UT
RORC cDNA ORF Clone, Rat, C-GFPSpark® tag RG81609-ACG
RORC Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81609-ACGLN
RORC cDNA ORF Clone, Rat, N-GFPSpark® tag RG81609-ANG
RORC cDNA ORF Clone, Rat, C-OFPSpark® tag RG81609-ACR
RORC cDNA ORF Clone, Rat, N-OFPSpark® tag RG81609-ANR
RORC cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81609-CF
RORC cDNA ORF Clone, Rat, C-His tag RG81609-CH
RORC cDNA ORF Clone, Rat, N-His tag RG81609-NH
RORC cDNA ORF Clone, Rat, C-HA tag RG81609-CY
RORC cDNA ORF Clone, Rat, N-HA tag RG81609-NY
RORC cDNA ORF Clone, Rat, C-Myc tag RG81609-CM
RORC cDNA ORF Clone, Rat, N-Myc tag RG81609-NM

RORC cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RORC cDNA ORF Clone in Cloning Vector, Human HG10718-U
RORC cDNA ORF Clone, Human, untagged HG10718-U-N
RORC cDNA ORF Clone, Human, untagged HG10718-UT
RORC cDNA ORF Clone, Human, untagged HG29699-UT
RORC Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10718-ACGLN
RORC Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG29699-ACGLN
RORC cDNA ORF Clone, Human, C-GFPSpark® tag HG29699-ACG
RORC cDNA ORF Clone, Human, C-GFPSpark® tag HG10718-ACG
RORC cDNA ORF Clone, Human, N-GFPSpark® tag HG10718-ANG
RORC cDNA ORF Clone, Human, C-OFPSpark® tag HG10718-ACR
RORC cDNA ORF Clone, Human, N-OFPSpark® tag HG10718-ANR
RORC cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10718-CF
RORC cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10718-U-F
RORC cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10718-NF
RORC cDNA ORF Clone, Human, C-His tag HG10718-CH
RORC cDNA ORF Clone, Human, N-His tag HG10718-NH
RORC cDNA ORF Clone, Human, C-HA tag HG10718-CY
RORC cDNA ORF Clone, Human, N-HA tag HG10718-NY
RORC cDNA ORF Clone, Human, C-Myc tag HG10718-CM
RORC cDNA ORF Clone, Human, N-Myc tag HG10718-NM
RORC qPCR Primer Pairs, Human HP100659
info info
添加购物车成功! 添加购物车失败!