LMAN2 cDNA ORF Clone, Rat, untagged

Cat: RG81022-UT

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All LMAN2 Reagents

CRO Services

Product recommended


All LMAN2 Reagents

LMAN2 cDNA ORF Clone, Rat, untagged General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1077 bp
Description
Full length Clone DNA of Rat lectin, mannose-binding 2.

Plasmid

Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LMAN2 Background Information

Full Name
lectin, mannose binding 2
References
  • Nawa D, et al. (2007) Stable interaction of the cargo receptor VIP36 with molecular chaperone BiP. Glycobiology. 17(9): 913-21.
  • Shimada O, et al. (2003) Localization of VIP36 in the post-Golgi secretory pathway also of rat parotid acinar cells. J Histochem Cytochem. 51(8): 1057-63.
  • Hara-Kuge S, et al. (1999) Vesicular-integral membrane protein, VIP36, recognizes high-mannose type glycans containing alpha1--2 mannosyl residues in MDCK cells. Glycobiology. 9(8): 833-9.
  • Fullekrug J, et al. (1999) VIP36 localisation to the early secretory pathway. J Cell Sci. 112 ( Pt 17): 2813-21.
  • LMAN2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    LMAN2 cDNA ORF Clone in Cloning Vector, Rat RG81022-U
    LMAN2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81022-ACGLN
    LMAN2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81022-ACG
    LMAN2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81022-ACR
    LMAN2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81022-CF
    LMAN2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81022-NF
    LMAN2 cDNA ORF Clone, Rat, C-His tag RG81022-CH
    LMAN2 cDNA ORF Clone, Rat, N-His tag RG81022-NH
    LMAN2 cDNA ORF Clone, Rat, C-HA tag RG81022-CY
    LMAN2 cDNA ORF Clone, Rat, N-HA tag RG81022-NY
    LMAN2 cDNA ORF Clone, Rat, C-Myc tag RG81022-CM
    LMAN2 cDNA ORF Clone, Rat, N-Myc tag RG81022-NM
    LMAN2 qPCR Primer Pairs, Rat RP300986

    LMAN2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    LMAN2 cDNA ORF Clone in Cloning Vector, Mouse MG5A5699-U
    LMAN2 cDNA ORF Clone, Mouse, untagged MG5A5699-UT
    LMAN2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5699-ACGLN
    LMAN2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5699-ACG
    LMAN2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A5699-ACR
    LMAN2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A5699-CF
    LMAN2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A5699-NF
    LMAN2 cDNA ORF Clone, Mouse, C-His tag MG5A5699-CH
    LMAN2 cDNA ORF Clone, Mouse, N-His tag MG5A5699-NH
    LMAN2 cDNA ORF Clone, Mouse, C-HA tag MG5A5699-CY
    LMAN2 cDNA ORF Clone, Mouse, N-HA tag MG5A5699-NY
    LMAN2 cDNA ORF Clone, Mouse, C-Myc tag MG5A5699-CM
    LMAN2 cDNA ORF Clone, Mouse, N-Myc tag MG5A5699-NM

    LMAN2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    LMAN2 cDNA ORF Clone in Cloning Vector, Human HG12455-U
    LMAN2 cDNA ORF Clone, Human, untagged HG12455-UT
    LMAN2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12455-ACGLN
    LMAN2 qPCR Primer Pairs, Human HP104790
    info info
    添加购物车成功! 添加购物车失败!