IL-22BP cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Cat: RG80203-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All IL-22BP Reagents
CRO Services
Product recommended

All IL-22BP Reagents
IL-22BP cDNA ORF Clone, Rat, N-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
690 bp
Description
Full length Clone DNA of Rat interleukin 22 receptor, alpha 2 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL-22BP Background Information

Interleukin-22 receptor subunit alpha-2 (IL-22RA2), also known as interleukin-22-binding protein (IL-22BP), is a subunit of the receptor for interleukin 22. IL-22BP belongs to the type I I cytokine receptor family and contains 3 fibronectin type-III domains. IL-22BP/IL-22RA2 is expressed in a range of tissues, including those in the digestive, female reproductive, and immune systems. It is expressed in placenta, spleen, breast, skin and lung. It is also detected in intestinal tract, testis, brain, heart and thymus. The dominant cell types expressing IL-22BP/IL-22RA2 were mononuclear cells and epithelium. IL-22BP/IL-22RA2 may play an important role as an IL-22 antagonist in the regulation of inflammatory responses. Interleukin-22 (IL-22) is a member of IL-10 family. It is produced by T cells and induces the production of acute-phase reactants. IL-22 plays important roles in immune response through activation of the STAT 3 signal transduction pathway. Two types of IL-22-binding receptor have been discovered, a membrane-bound receptor and a soluble receptor.

Full Name
interleukin 22 receptor, alpha 2
References
  • Whittington HA, et al. (2004) Interleukin-22: a potential immunomodulatory molecule in the lung. Am J Respir Cell Mol Biol. 31(2): 220-6.
  • Dumoutier L, et al. (2001) Cloning and characterization of IL-22 binding protein, a natural antagonist of IL-10-related T cell-derived inducible factor/IL-22. J Immunol. 166(12): 7090-5.
  • Wei CC, et al. (2003) Cloning and characterization of mouse IL-22 binding protein. Genes Immun. 4(3): 204-11.
  • IL-22BP cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IL-22BP cDNA ORF Clone in Cloning Vector, Rat RG80203-G
    IL-22BP cDNA ORF Clone, Rat, untagged RG80203-UT
    IL-22BP Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80203-ACGLN
    IL-22BP cDNA ORF Clone, Rat, C-GFPSpark® tag RG80203-ACG
    IL-22BP cDNA ORF Clone, Rat, C-OFPSpark® tag RG80203-ACR
    IL-22BP cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80203-CF
    IL-22BP cDNA ORF Clone, Rat, C-His tag RG80203-CH
    IL-22BP cDNA ORF Clone, Rat, N-His tag RG80203-NH
    IL-22BP cDNA ORF Clone, Rat, C-HA tag RG80203-CY
    IL-22BP cDNA ORF Clone, Rat, N-HA tag RG80203-NY
    IL-22BP cDNA ORF Clone, Rat, C-Myc tag RG80203-CM
    IL-22BP cDNA ORF Clone, Rat, N-Myc tag RG80203-NM
    IL-22BP qPCR Primer Pairs, Rat RP300195

    IL-22BP cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IL-22BP cDNA ORF Clone in Cloning Vector, Mouse MG50102-M
    IL-22BP cDNA ORF Clone, Mouse, untagged MG50102-UT
    IL-22BP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50102-ACGLN
    IL-22BP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50102-ACG
    IL-22BP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50102-ACR
    IL-22BP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50102-CF
    IL-22BP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50102-NF
    IL-22BP cDNA ORF Clone, Mouse, C-His tag MG50102-CH
    IL-22BP cDNA ORF Clone, Mouse, N-His tag MG50102-NH
    IL-22BP cDNA ORF Clone, Mouse, C-HA tag MG50102-CY
    IL-22BP cDNA ORF Clone, Mouse, N-HA tag MG50102-NY
    IL-22BP cDNA ORF Clone, Mouse, C-Myc tag MG50102-CM
    IL-22BP cDNA ORF Clone, Mouse, N-Myc tag MG50102-NM
    IL-22BP qPCR Primer Pairs, Mouse MP200132

    IL-22BP cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL-22BP cDNA ORF Clone in Cloning Vector, Human HG10781-M
    IL-22BP cDNA ORF Clone in Cloning Vector, Human HG11025-M
    IL-22BP cDNA ORF Clone, Human, untagged HG10781-UT
    IL-22BP cDNA ORF Clone, Human, untagged HG11025-UT
    IL-22BP cDNA ORF Clone, Human, C-GFPSpark® tag HG10781-ACG
    IL-22BP cDNA ORF Clone, Human, C-GFPSpark® tag HG11025-ACG
    IL-22BP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11025-ACGLN
    IL-22BP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10781-ACGLN
    IL-22BP cDNA ORF Clone, Human, C-OFPSpark® tag HG10781-ACR
    IL-22BP cDNA ORF Clone, Human, C-OFPSpark® tag HG11025-ACR
    IL-22BP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11025-CF
    IL-22BP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10781-CF
    IL-22BP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10781-NF
    IL-22BP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11025-NF
    IL-22BP cDNA ORF Clone, Human, C-His tag HG10781-CH
    IL-22BP cDNA ORF Clone, Human, C-His tag HG11025-CH
    IL-22BP cDNA ORF Clone, Human, N-His tag HG10781-NH
    IL-22BP cDNA ORF Clone, Human, N-His tag HG11025-NH
    IL-22BP cDNA ORF Clone, Human, C-HA tag HG10781-CY
    IL-22BP cDNA ORF Clone, Human, C-HA tag HG11025-CY
    IL-22BP cDNA ORF Clone, Human, N-HA tag HG11025-NY
    IL-22BP cDNA ORF Clone, Human, N-HA tag HG10781-NY
    IL-22BP cDNA ORF Clone, Human, C-Myc tag HG10781-CM
    IL-22BP cDNA ORF Clone, Human, C-Myc tag HG11025-CM
    IL-22BP cDNA ORF Clone, Human, N-Myc tag HG11025-NM
    IL-22BP cDNA ORF Clone, Human, N-Myc tag HG10781-NM
    IL-22BP qPCR Primer Pairs, Human HP100699
    info info
    添加购物车成功! 添加购物车失败!