IL22 cDNA ORF Clone, Rat, N-HA tag

Cat: RG80463-NY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All IL22 Reagents

CRO Services

Product recommended


All IL22 Reagents

IL22 cDNA ORF Clone, Rat, N-HA tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
540 bp
Description
Full length Clone DNA of Rat interleukin 22 with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL22 Background Information

IL22 is a member of a group of cytokines called the IL-10 family or IL-10 superfamily (including IL-19, IL-20, IL-24, and IL-26),  a class of potent mediators of cellular inflammatory responses. It shares use of IL-10R2 in cell signaling with other members of this family, IL-10, IL-26, IL-28A/B and IL-29. IL22 is produced by activated DC and T cells and initiates innate immune responses against bacterial pathogens especially in epithelial cells such as respiratory and gut epithelial cells. IL22 along with IL-17 is rapidly produced by splenic LTi-like cells and can be also produced by Th17 cells and likely plays a role in the coordinated response of both adaptive and innate immune systems.

IL22 biological activity is initiated by binding to a cell-surface complex composed of IL-22R1 and IL-10R2 receptor chains and further regulated by interactions with a soluble binding protein, IL-22BP, which shares sequence similarity with an extracellular region of IL-22R1 (sIL-22R1). IL22 and IL-10 receptor chains play a role in cellular targeting and signal transduction to selectively initiate and regulate immune responses. IL22 can contribute to immune disease through the stimulation of inflammatory responses, S100s and defensins. IL22 also promotes hepatocyte survival in the liver and epithelial cells in the lung and gut similar to IL-10. In some contexts, the pro-inflammatory versus tissue-protective functions of IL22 are regulated by the often co-expressed cytokine IL-17A.

Full Name
interleukin 22
References
  • Pestka S. et al., 2004, Annu Rev Immunol. 22: 929-79.
  • Xie MH. et al., 2000, J Biol Chem. 275 (40): 31335-9.
  • Jones BC. et al., 2008, Structure. 16 (9): 1333-44.
  • IL22 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IL22 cDNA ORF Clone in Cloning Vector, Rat RG80463-G
    IL22 cDNA ORF Clone, Rat, untagged RG80463-UT
    IL22 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80463-ACGLN
    IL22 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80463-ACG
    IL22 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80463-ACR
    IL22 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80463-CF
    IL22 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80463-NF
    IL22 cDNA ORF Clone, Rat, C-His tag RG80463-CH
    IL22 cDNA ORF Clone, Rat, N-His tag RG80463-NH
    IL22 cDNA ORF Clone, Rat, C-HA tag RG80463-CY
    IL22 cDNA ORF Clone, Rat, C-Myc tag RG80463-CM
    IL22 cDNA ORF Clone, Rat, N-Myc tag RG80463-NM
    IL22 qPCR Primer Pairs, Rat RP300428

    IL22 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IL22 cDNA ORF Clone in Cloning Vector, Mouse MG51085-G
    IL22 cDNA ORF Clone, Mouse, untagged MG51085-UT
    IL22 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51085-ACG
    IL22 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51085-ACGLN
    IL22 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51085-ACR
    IL22 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51085-CF
    IL22 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51085-NF
    IL22 cDNA ORF Clone, Mouse, C-His tag MG51085-CH
    IL22 cDNA ORF Clone, Mouse, N-His tag MG51085-NH
    IL22 cDNA ORF Clone, Mouse, C-HA tag MG51085-CY
    IL22 cDNA ORF Clone, Mouse, N-HA tag MG51085-NY
    IL22 cDNA ORF Clone, Mouse, C-Myc tag MG51085-CM
    IL22 cDNA ORF Clone, Mouse, N-Myc tag MG51085-NM
    IL22 qPCR Primer Pairs, Mouse MP201043

    IL22 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL22 cDNA ORF Clone, Human, untagged HG13059-UT
    IL22 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13059-ACGLN
    IL22 cDNA ORF Clone, Human, C-His tag HG13059-CH
    IL22 qPCR Primer Pairs, Human HP104906
    info info
    添加购物车成功! 添加购物车失败!