G6PD cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG81135-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All G6PD Reagents
CRO Services
Product recommended

All G6PD Reagents
G6PD cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1548 bp
Description
Full length Clone DNA of Rat glucose-6-phosphate dehydrogenase with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

G6PD Background Information
Full Name
glucose-6-phosphate dehydrogenase

G6PD cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
G6PD cDNA ORF Clone in Cloning Vector, Rat RG81135-U
G6PD cDNA ORF Clone, Rat, untagged RG81135-UT
G6PD Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81135-ACGLN
G6PD cDNA ORF Clone, Rat, C-GFPSpark® tag RG81135-ACG
G6PD cDNA ORF Clone, Rat, N-GFPSpark® tag RG81135-ANG
G6PD cDNA ORF Clone, Rat, C-OFPSpark® tag RG81135-ACR
G6PD cDNA ORF Clone, Rat, N-OFPSpark® tag RG81135-ANR
G6PD cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81135-NF
G6PD cDNA ORF Clone, Rat, C-His tag RG81135-CH
G6PD cDNA ORF Clone, Rat, N-His tag RG81135-NH
G6PD cDNA ORF Clone, Rat, C-HA tag RG81135-CY
G6PD cDNA ORF Clone, Rat, N-HA tag RG81135-NY
G6PD cDNA ORF Clone, Rat, C-Myc tag RG81135-CM
G6PD cDNA ORF Clone, Rat, N-Myc tag RG81135-NM
G6PD qPCR Primer Pairs, Rat RP301092

G6PD cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
G6PD cDNA ORF Clone in Cloning Vector, Human HG12021-G
G6PD cDNA ORF Clone, Human, untagged HG12021-UT
G6PD cDNA ORF Clone, Human, C-GFPSpark® tag HG12021-ACG
G6PD Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12021-ACGLN
G6PD cDNA ORF Clone, Human, N-GFPSpark® tag HG12021-ANG
G6PD cDNA ORF Clone, Human, C-OFPSpark® tag HG12021-ACR
G6PD cDNA ORF Clone, Human, N-OFPSpark® tag HG12021-ANR
G6PD cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12021-CF
G6PD cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12021-NF
G6PD cDNA ORF Clone, Human, C-His tag HG12021-CH
G6PD cDNA ORF Clone, Human, N-His tag HG12021-NH
G6PD cDNA ORF Clone, Human, C-HA tag HG12021-CY
G6PD cDNA ORF Clone, Human, N-HA tag HG12021-NY
G6PD cDNA ORF Clone, Human, C-Myc tag HG12021-CM
G6PD cDNA ORF Clone, Human, N-Myc tag HG12021-NM
G6PD qPCR Primer Pairs, Human HP101557
info info
添加购物车成功! 添加购物车失败!