FMO3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Cat: RG81595-NF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All FMO3 Reagents

CRO Services

Product recommended


All FMO3 Reagents

FMO3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1596 bp
Description
Full length Clone DNA of Rat flavin containing monooxygenase 3 with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FMO3 Background Information

Full Name
flavin containing monooxygenase 3

FMO3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
FMO3 cDNA ORF Clone in Cloning Vector, Rat RG81595-G
FMO3 cDNA ORF Clone, Rat, untagged RG81595-UT
FMO3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81595-ACG
FMO3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81595-ACGLN
FMO3 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81595-ANG
FMO3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81595-ACR
FMO3 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81595-ANR
FMO3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81595-CF
FMO3 cDNA ORF Clone, Rat, C-His tag RG81595-CH
FMO3 cDNA ORF Clone, Rat, N-His tag RG81595-NH
FMO3 cDNA ORF Clone, Rat, C-HA tag RG81595-CY
FMO3 cDNA ORF Clone, Rat, N-HA tag RG81595-NY
FMO3 cDNA ORF Clone, Rat, C-Myc tag RG81595-CM
FMO3 cDNA ORF Clone, Rat, N-Myc tag RG81595-NM

FMO3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FMO3 cDNA ORF Clone in Cloning Vector, Human HG14846-G
FMO3 cDNA ORF Clone, Human, untagged HG14846-UT
FMO3 cDNA ORF Clone, Human, C-GFPSpark® tag HG14846-ACG
FMO3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14846-ACGLN
FMO3 cDNA ORF Clone, Human, C-OFPSpark® tag HG14846-ACR
FMO3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14846-CF
FMO3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14846-NF
FMO3 cDNA ORF Clone, Human, C-His tag HG14846-CH
FMO3 cDNA ORF Clone, Human, N-His tag HG14846-NH
FMO3 cDNA ORF Clone, Human, C-HA tag HG14846-CY
FMO3 cDNA ORF Clone, Human, N-HA tag HG14846-NY
FMO3 cDNA ORF Clone, Human, C-Myc tag HG14846-CM
FMO3 cDNA ORF Clone, Human, N-Myc tag HG14846-NM
FMO3 qPCR Primer Pairs, Human HP103477
info info
添加购物车成功! 添加购物车失败!