Desmin cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Cat: RG81599-NF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All Desmin Reagents

CRO Services

Product recommended


All Desmin Reagents

Desmin cDNA ORF Clone, Rat, N-DDK (Flag®) tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1410 bp
Description
Full length Clone DNA of Rat desmin with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Desmin Background Information

Full Name
desmin

Desmin cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Desmin cDNA ORF Clone in Cloning Vector, Rat RG81599-G
Desmin cDNA ORF Clone, Rat, untagged RG81599-UT
Desmin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81599-ACGLN
Desmin cDNA ORF Clone, Rat, C-GFPSpark® tag RG81599-ACG
Desmin cDNA ORF Clone, Rat, N-GFPSpark® tag RG81599-ANG
Desmin cDNA ORF Clone, Rat, C-OFPSpark® tag RG81599-ACR
Desmin cDNA ORF Clone, Rat, N-OFPSpark® tag RG81599-ANR
Desmin cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81599-CF
Desmin cDNA ORF Clone, Rat, C-His tag RG81599-CH
Desmin cDNA ORF Clone, Rat, N-His tag RG81599-NH
Desmin cDNA ORF Clone, Rat, C-HA tag RG81599-CY
Desmin cDNA ORF Clone, Rat, N-HA tag RG81599-NY
Desmin cDNA ORF Clone, Rat, C-Myc tag RG81599-CM
Desmin cDNA ORF Clone, Rat, N-Myc tag RG81599-NM

Desmin cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Desmin cDNA ORF Clone in Cloning Vector, Mouse MG57000-U
Desmin cDNA ORF Clone, Mouse, untagged MG57000-UT
Desmin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57000-ACGLN
Desmin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57000-ACG
Desmin cDNA ORF Clone, Mouse, N-GFPSpark® tag MG57000-ANG
Desmin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG57000-ACR
Desmin cDNA ORF Clone, Mouse, N-OFPSpark® tag MG57000-ANR
Desmin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG57000-CF
Desmin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG57000-NF
Desmin cDNA ORF Clone, Mouse, C-His tag MG57000-CH
Desmin cDNA ORF Clone, Mouse, N-His tag MG57000-NH
Desmin cDNA ORF Clone, Mouse, C-HA tag MG57000-CY
Desmin cDNA ORF Clone, Mouse, N-HA tag MG57000-NY
Desmin cDNA ORF Clone, Mouse, C-Myc tag MG57000-CM
Desmin cDNA ORF Clone, Mouse, N-Myc tag MG57000-NM

Desmin cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Desmin cDNA ORF Clone in Cloning Vector, Human HG13865-G
Desmin cDNA ORF Clone, Human, untagged HG13865-UT
Desmin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13865-ACGLN
Desmin cDNA ORF Clone, Human, C-GFPSpark® tag HG13865-ACG
Desmin cDNA ORF Clone, Human, N-GFPSpark® tag HG13865-ANG
Desmin cDNA ORF Clone, Human, C-OFPSpark® tag HG13865-ACR
Desmin cDNA ORF Clone, Human, N-OFPSpark® tag HG13865-ANR
Desmin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13865-CF
Desmin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13865-NF
Desmin cDNA ORF Clone, Human, C-His tag HG13865-CH
Desmin cDNA ORF Clone, Human, N-His tag HG13865-NH
Desmin cDNA ORF Clone, Human, C-HA tag HG13865-CY
Desmin cDNA ORF Clone, Human, N-HA tag HG13865-NY
Desmin cDNA ORF Clone, Human, C-Myc tag HG13865-CM
Desmin cDNA ORF Clone, Human, N-Myc tag HG13865-NM
Desmin qPCR Primer Pairs, Human HP102536
info info
添加购物车成功! 添加购物车失败!