DDR2 cDNA ORF Clone, Rat, N-His tag

Cat: RG80341-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All DDR2 Reagents
CRO Services
Product recommended

All DDR2 Reagents
DDR2 cDNA ORF Clone, Rat, N-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2565 bp
Description
Full length Clone DNA of Rat discoidin domain receptor tyrosine kinase 2 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DDR2 Background Information

Discoidin domain receptor 2 (DDR2) or CD167b (cluster of differentiation 167b) is a kind of protein tyrosine kinases associated with cell proliferation and tumor metastasis, and collagen, identified as a ligand for DDR2, up-regulates matrix metallloproteinase 1 (MMP-1) and MMP-2 expression in cellular matrix. DDR2/CD167b was found to recognise the triple-helical region of collagen X as well as the NC1 domain. Binding to the collagenous region was dependent on the triple-helical conformation. DDR2/CD167b autophosphorylation was induced by the collagen X triple-helical region but not the NC1 domain, indicating that the triple-helical region of collagen X contains a specific DDR2 binding site that is capable of receptor activation. DDR2/CD167b is induced during stellate cell activation and implicate the phosphorylated receptor as a mediator of MMP-2 release and growth stimulation in response to type I collagen. Moreover, type I collagen-dependent upregulation of DDR2/CD167b expression establishes a positive feedback loop in activated stellate cells, leading to further proliferation and enhanced invasive activity.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
discoidin domain receptor tyrosine kinase 2
References
  • Olaso E, et al. (2001) DDR2 receptor promotes MMP-2-mediated proliferation and invasion by hepatic stellate cells. J Clin Invest. 108(9): 1369-78.
  • Zhang W, et al. (2006) Expression of discoidin domain receptor 2 (DDR2) extracellular domain in pichia pastoris and functional analysis in synovial fibroblasts and NIT3T3 cells. Mol Cell Biochem. 290(1-2): 43-53.
  • Leitinger B, et al. (2006) The discoidin domain receptor DDR2 is a receptor for type X collagen. Matrix Biol. 25(6): 355-64.
  • Leitinger B, et al. (2004) The D2 period of collagen II contains a specific binding site for the human discoidin domain receptor, DDR2. J Mol Biol. 344(4): 993-1003.
  • DDR2 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    DDR2 cDNA ORF Clone in Cloning Vector, Rhesus CG90228-G
    DDR2 cDNA ORF Clone, Rhesus, untagged CG90228-UT
    DDR2 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90228-ACGLN
    DDR2 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90228-ACG
    DDR2 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90228-ACR
    DDR2 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90228-CF
    DDR2 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90228-NF
    DDR2 cDNA ORF Clone, Rhesus, C-His tag CG90228-CH
    DDR2 cDNA ORF Clone, Rhesus, N-His tag CG90228-NH
    DDR2 cDNA ORF Clone, Rhesus, C-HA tag CG90228-CY
    DDR2 cDNA ORF Clone, Rhesus, N-HA tag CG90228-NY
    DDR2 cDNA ORF Clone, Rhesus, C-Myc tag CG90228-CM
    DDR2 cDNA ORF Clone, Rhesus, N-Myc tag CG90228-NM

    DDR2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    DDR2 cDNA ORF Clone in Cloning Vector, Rat RG80341-G
    DDR2 cDNA ORF Clone, Rat, untagged RG80341-UT
    DDR2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80341-ACG
    DDR2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80341-ACGLN
    DDR2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80341-ACR
    DDR2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80341-CF
    DDR2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80341-NF
    DDR2 cDNA ORF Clone, Rat, C-His tag RG80341-CH
    DDR2 cDNA ORF Clone, Rat, C-HA tag RG80341-CY
    DDR2 cDNA ORF Clone, Rat, N-HA tag RG80341-NY
    DDR2 cDNA ORF Clone, Rat, C-Myc tag RG80341-CM
    DDR2 cDNA ORF Clone, Rat, N-Myc tag RG80341-NM
    DDR2 qPCR Primer Pairs, Rat RP300311

    DDR2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    DDR2 cDNA ORF Clone in Cloning Vector, Mouse MG50541-M
    DDR2 cDNA ORF Clone, Mouse, untagged MG50541-UT
    DDR2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50541-ACGLN
    DDR2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50541-ACG
    DDR2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50541-ACR
    DDR2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50541-CF
    DDR2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50541-NF
    DDR2 cDNA ORF Clone, Mouse, C-His tag MG50541-CH
    DDR2 cDNA ORF Clone, Mouse, N-His tag MG50541-NH
    DDR2 cDNA ORF Clone, Mouse, C-HA tag MG50541-CY
    DDR2 cDNA ORF Clone, Mouse, N-HA tag MG50541-NY
    DDR2 cDNA ORF Clone, Mouse, C-Myc tag MG50541-CM
    DDR2 cDNA ORF Clone, Mouse, N-Myc tag MG50541-NM
    DDR2 qPCR Primer Pairs, Mouse MP200533

    DDR2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    DDR2 cDNA ORF Clone in Cloning Vector, Human HG10209-M
    DDR2 cDNA ORF Clone, Human, untagged HG10209-UT
    DDR2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10209-ACG
    DDR2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10209-ACGLN
    DDR2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10209-ACR
    DDR2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10209-CF
    DDR2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10209-NF
    DDR2 cDNA ORF Clone, Human, C-His tag HG10209-CH
    DDR2 cDNA ORF Clone, Human, N-His tag HG10209-NH
    DDR2 cDNA ORF Clone, Human, C-HA tag HG10209-CY
    DDR2 cDNA ORF Clone, Human, N-HA tag HG10209-NY
    DDR2 cDNA ORF Clone, Human, C-Myc tag HG10209-CM
    DDR2 cDNA ORF Clone, Human, N-Myc tag HG10209-NM
    DDR2 qPCR Primer Pairs, Human HP100268
    info info
    添加购物车成功! 添加购物车失败!