Acidic Calponin/CNN3 cDNA ORF Clone, Rat, untagged

Cat: RG81013-UT

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All Acidic Calponin/CNN3 Reagents

CRO Services

Product recommended


All Acidic Calponin/CNN3 Reagents

Acidic Calponin/CNN3 cDNA ORF Clone, Rat, untagged General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
993 bp
Description
Full length Clone DNA of Rat calponin 3, acidic.

Plasmid

Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Acidic Calponin/CNN3 Background Information

Full Name
calponin 3, acidic

Acidic Calponin/CNN3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Acidic Calponin/CNN3 cDNA ORF Clone in Cloning Vector, Rat RG81013-U
Acidic Calponin/CNN3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81013-ACG
Acidic Calponin/CNN3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81013-ACGLN
Acidic Calponin/CNN3 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81013-ANG
Acidic Calponin/CNN3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81013-ACR
Acidic Calponin/CNN3 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81013-ANR
Acidic Calponin/CNN3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81013-CF
Acidic Calponin/CNN3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81013-NF
Acidic Calponin/CNN3 cDNA ORF Clone, Rat, C-His tag RG81013-CH
Acidic Calponin/CNN3 cDNA ORF Clone, Rat, N-His tag RG81013-NH
Acidic Calponin/CNN3 cDNA ORF Clone, Rat, C-HA tag RG81013-CY
Acidic Calponin/CNN3 cDNA ORF Clone, Rat, N-HA tag RG81013-NY
Acidic Calponin/CNN3 cDNA ORF Clone, Rat, C-Myc tag RG81013-CM
Acidic Calponin/CNN3 cDNA ORF Clone, Rat, N-Myc tag RG81013-NM
Acidic Calponin/CNN3 qPCR Primer Pairs, Rat RP300977

Acidic Calponin/CNN3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Acidic Calponin/CNN3 cDNA ORF Clone in Cloning Vector, Human HG15309-G
Acidic Calponin/CNN3 cDNA ORF Clone, Human, untagged HG15309-UT
Acidic Calponin/CNN3 cDNA ORF Clone, Human, C-GFPSpark® tag HG15309-ACG
Acidic Calponin/CNN3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15309-ACGLN
Acidic Calponin/CNN3 cDNA ORF Clone, Human, N-GFPSpark® tag HG15309-ANG
Acidic Calponin/CNN3 cDNA ORF Clone, Human, C-OFPSpark® tag HG15309-ACR
Acidic Calponin/CNN3 cDNA ORF Clone, Human, N-OFPSpark® tag HG15309-ANR
Acidic Calponin/CNN3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15309-CF
Acidic Calponin/CNN3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15309-NF
Acidic Calponin/CNN3 cDNA ORF Clone, Human, C-His tag HG15309-CH
Acidic Calponin/CNN3 cDNA ORF Clone, Human, N-His tag HG15309-NH
Acidic Calponin/CNN3 cDNA ORF Clone, Human, C-HA tag HG15309-CY
Acidic Calponin/CNN3 cDNA ORF Clone, Human, N-HA tag HG15309-NY
Acidic Calponin/CNN3 cDNA ORF Clone, Human, C-Myc tag HG15309-CM
Acidic Calponin/CNN3 cDNA ORF Clone, Human, N-Myc tag HG15309-NM
Acidic Calponin/CNN3 qPCR Primer Pairs, Human HP103935
info info
添加购物车成功! 添加购物车失败!