CLEC4A2 cDNA ORF Clone, Rat, C-His tag

Cat: RG80267-CH

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All CLEC4A2 Reagents

CRO Services

Product recommended


All CLEC4A2 Reagents

CLEC4A2 cDNA ORF Clone, Rat, C-His tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
708 bp
Description
Full length Clone DNA of Rat C-type lectin domain family 4, member A2 with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CLEC4A2 cDNA ORF Clone, Rat, C-His tag Alternative Names

CLEC4A2 cDNA ORF Clone, Rat;Dcir2 cDNA ORF Clone, Rat

CLEC4A2 Background Information

Full Name
C-type lectin domain family 4, member a2

CLEC4A2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CLEC4A2 cDNA ORF Clone in Cloning Vector, Rat RG80267-G
CLEC4A2 cDNA ORF Clone, Rat, untagged RG80267-UT
CLEC4A2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80267-ACG
CLEC4A2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80267-ACGLN
CLEC4A2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80267-ACR
CLEC4A2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80267-CF
CLEC4A2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80267-NF
CLEC4A2 cDNA ORF Clone, Rat, N-His tag RG80267-NH
CLEC4A2 cDNA ORF Clone, Rat, C-HA tag RG80267-CY
CLEC4A2 cDNA ORF Clone, Rat, N-HA tag RG80267-NY
CLEC4A2 cDNA ORF Clone, Rat, C-Myc tag RG80267-CM
CLEC4A2 cDNA ORF Clone, Rat, N-Myc tag RG80267-NM
CLEC4A2 qPCR Primer Pairs, Rat RP300251

CLEC4A2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CLEC4A2 cDNA ORF Clone in Cloning Vector, Mouse MG50945-G
CLEC4A2 cDNA ORF Clone, Mouse, untagged MG50945-UT
CLEC4A2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50945-ACG
CLEC4A2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50945-ACGLN
CLEC4A2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50945-ACR
CLEC4A2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50945-CF
CLEC4A2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50945-NF
CLEC4A2 cDNA ORF Clone, Mouse, C-His tag MG50945-CH
CLEC4A2 cDNA ORF Clone, Mouse, N-His tag MG50945-NH
CLEC4A2 cDNA ORF Clone, Mouse, C-HA tag MG50945-CY
CLEC4A2 cDNA ORF Clone, Mouse, N-HA tag MG50945-NY
CLEC4A2 cDNA ORF Clone, Mouse, C-Myc tag MG50945-CM
CLEC4A2 cDNA ORF Clone, Mouse, N-Myc tag MG50945-NM
CLEC4A2 qPCR Primer Pairs, Mouse MP200914
info info
添加购物车成功! 添加购物车失败!