CCRK cDNA ORF Clone, Rat, N-His tag

Cat: RG81634-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CCRK Reagents
CRO Services
Product recommended

All CCRK Reagents
CCRK cDNA ORF Clone, Rat, N-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1041 bp
Description
Full length Clone DNA of Rat cyclin-dependent kinase 20 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CCRK Background Information
Full Name
cyclin-dependent kinase 20

CCRK cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CCRK cDNA ORF Clone in Cloning Vector, Rat RG81634-G
CCRK cDNA ORF Clone, Rat, untagged RG81634-UT
CCRK cDNA ORF Clone, Rat, C-GFPSpark® tag RG81634-ACG
CCRK Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81634-ACGLN
CCRK cDNA ORF Clone, Rat, C-OFPSpark® tag RG81634-ACR
CCRK cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81634-CF
CCRK cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81634-NF
CCRK cDNA ORF Clone, Rat, C-His tag RG81634-CH
CCRK cDNA ORF Clone, Rat, C-HA tag RG81634-CY
CCRK cDNA ORF Clone, Rat, N-HA tag RG81634-NY
CCRK cDNA ORF Clone, Rat, C-Myc tag RG81634-CM
CCRK cDNA ORF Clone, Rat, N-Myc tag RG81634-NM

CCRK cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CCRK cDNA ORF Clone in Cloning Vector, Human HG12199-G
CCRK cDNA ORF Clone, Human, untagged HG12199-UT
CCRK Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12199-ACGLN
CCRK cDNA ORF Clone, Human, C-GFPSpark® tag HG12199-ACG
CCRK cDNA ORF Clone, Human, N-GFPSpark® tag HG12199-ANG
CCRK cDNA ORF Clone, Human, C-OFPSpark® tag HG12199-ACR
CCRK cDNA ORF Clone, Human, N-OFPSpark® tag HG12199-ANR
CCRK cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12199-CF
CCRK cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12199-NF
CCRK cDNA ORF Clone, Human, C-His tag HG12199-CH
CCRK cDNA ORF Clone, Human, N-His tag HG12199-NH
CCRK cDNA ORF Clone, Human, C-HA tag HG12199-CY
CCRK cDNA ORF Clone, Human, N-HA tag HG12199-NY
CCRK cDNA ORF Clone, Human, C-Myc tag HG12199-CM
CCRK cDNA ORF Clone, Human, N-Myc tag HG12199-NM
CCRK qPCR Primer Pairs, Human HP101826
info info
添加购物车成功! 添加购物车失败!