CD82 cDNA ORF Clone, Rat, N-His tag

Cat: RG80332-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CD82 Reagents
CRO Services
Product recommended

All CD82 Reagents
CD82 cDNA ORF Clone, Rat, N-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
801 bp
Description
Full length Clone DNA of Rat Cd82 molecule with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD82 Background Information

CD82, also known as KAI-1, structurally belongs to tetraspanin family while categorised as metastasis suppressor gene on functional grounds. KAI1/CD82 is localized on cell membrane and form interactions with other tetraspanins, integrins and chemokines which are respectively responsible for cell migration, adhesion and signalling. Downregulation of CD82 expression is associated with the advanced stages of many human cancers and correlates with the acquisition of metastatic potential. Recent studies suggest that complex mechanisms underlie CD82 loss of function, including altered transcriptional regulation, splice variant production and post-translational protein modifications, and indicate a central role for CD82 in controlling metastasis as a 'molecular facilitator'. The loss of KAI1/CD82 expression in invasive and metastatic cancers is due to a complex, epigenetic mechanism that probably involves transcription factors such as NFkappaB, p53, and beta-catenin. A loss of KAI1 expression is also associated with the advanced stages of many human malignancies and results in the acquisition of invasive and metastatic capabilities by tumour cells. Thus, KAI1/CD82 is regarded as a wide-spectrum tumor metastasis suppressor.

Full Name
CD82 molecule
References
  • Malik FA, et al. (2009) KAI-1/CD82, the molecule and clinical implication in cancer and cancer metastasis. Histol Histopathol. 24(4): 519-30.
  • Liu WM, et al. (2006) KAI1/CD82, a tumor metastasis suppressor. Cancer Lett. 240(2): 183-94.
  • Tonoli H, et al. (2006) CD82 metastasis suppressor gene: a potential target for new therapeutics? Trends Mol Med. 11(12): 563-70.
  • Jackson P, et al. (2005) KAI1 tetraspanin and metastasis suppressor. Int J Biochem Cell Biol. 37(3): 530-4.
  • CD82 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    CD82 cDNA ORF Clone in Cloning Vector, Rhesus CG90202-G
    CD82 cDNA ORF Clone, Rhesus, untagged CG90202-UT
    CD82 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90202-ACGLN
    CD82 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90202-ACG
    CD82 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90202-ACR
    CD82 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90202-CF
    CD82 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90202-NF
    CD82 cDNA ORF Clone, Rhesus, C-His tag CG90202-CH
    CD82 cDNA ORF Clone, Rhesus, N-His tag CG90202-NH
    CD82 cDNA ORF Clone, Rhesus, C-HA tag CG90202-CY
    CD82 cDNA ORF Clone, Rhesus, N-HA tag CG90202-NY
    CD82 cDNA ORF Clone, Rhesus, C-Myc tag CG90202-CM
    CD82 cDNA ORF Clone, Rhesus, N-Myc tag CG90202-NM

    CD82 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD82 cDNA ORF Clone in Cloning Vector, Rat RG80332-G
    CD82 cDNA ORF Clone, Rat, untagged RG80332-UT
    CD82 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80332-ACGLN
    CD82 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80332-ACG
    CD82 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80332-ACR
    CD82 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80332-CF
    CD82 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80332-NF
    CD82 cDNA ORF Clone, Rat, C-His tag RG80332-CH
    CD82 cDNA ORF Clone, Rat, C-HA tag RG80332-CY
    CD82 cDNA ORF Clone, Rat, N-HA tag RG80332-NY
    CD82 cDNA ORF Clone, Rat, C-Myc tag RG80332-CM
    CD82 cDNA ORF Clone, Rat, N-Myc tag RG80332-NM
    CD82 qPCR Primer Pairs, Rat RP300302

    CD82 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD82 cDNA ORF Clone in Cloning Vector, Mouse MG50744-G
    CD82 cDNA ORF Clone, Mouse, untagged MG50744-UT
    CD82 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50744-ACGLN
    CD82 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50744-ACG
    CD82 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50744-ACR
    CD82 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50744-CF
    CD82 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50744-NF
    CD82 cDNA ORF Clone, Mouse, C-His tag MG50744-CH
    CD82 cDNA ORF Clone, Mouse, N-His tag MG50744-NH
    CD82 cDNA ORF Clone, Mouse, C-HA tag MG50744-CY
    CD82 cDNA ORF Clone, Mouse, N-HA tag MG50744-NY
    CD82 cDNA ORF Clone, Mouse, C-Myc tag MG50744-CM
    CD82 cDNA ORF Clone, Mouse, N-Myc tag MG50744-NM
    CD82 qPCR Primer Pairs, Mouse MP200719

    CD82 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD82 cDNA ORF Clone in Cloning Vector, Human HG12275-G
    CD82 cDNA ORF Clone, Human, untagged HG12275-UT
    CD82 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12275-ACGLN
    CD82 cDNA ORF Clone, Human, C-GFPSpark® tag HG12275-ACG
    CD82 cDNA ORF Clone, Human, C-OFPSpark® tag HG12275-ACR
    CD82 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12275-CF
    CD82 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12275-NF
    CD82 cDNA ORF Clone, Human, C-His tag HG12275-CH
    CD82 cDNA ORF Clone, Human, N-His tag HG12275-NH
    CD82 cDNA ORF Clone, Human, C-HA tag HG12275-CY
    CD82 cDNA ORF Clone, Human, N-HA tag HG12275-NY
    CD82 cDNA ORF Clone, Human, C-Myc tag HG12275-CM
    CD82 cDNA ORF Clone, Human, N-Myc tag HG12275-NM
    CD82 qPCR Primer Pairs, Human HP101886
    info info
    添加购物车成功! 添加购物车失败!