CD320 cDNA ORF Clone, Rat, C-HA tag

Cat: RG80375-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CD320 Reagents
CRO Services
Product recommended

All CD320 Reagents
CD320 cDNA ORF Clone, Rat, C-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
795 bp
Description
Full length Clone DNA of Rat CD320 molecule with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD320 Background Information
Full Name
CD320 molecule

CD320 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CD320 cDNA ORF Clone in Cloning Vector, Rat RG80375-G
CD320 cDNA ORF Clone, Rat, untagged RG80375-UT
CD320 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80375-ACGLN
CD320 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80375-ACG
CD320 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80375-ACR
CD320 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80375-CF
CD320 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80375-NF
CD320 cDNA ORF Clone, Rat, C-His tag RG80375-CH
CD320 cDNA ORF Clone, Rat, N-His tag RG80375-NH
CD320 cDNA ORF Clone, Rat, N-HA tag RG80375-NY
CD320 cDNA ORF Clone, Rat, C-Myc tag RG80375-CM
CD320 cDNA ORF Clone, Rat, N-Myc tag RG80375-NM
CD320 qPCR Primer Pairs, Rat RP300342

CD320 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CD320 cDNA ORF Clone in Cloning Vector, Mouse MG51138-G
CD320 cDNA ORF Clone, Mouse, untagged MG51138-UT
CD320 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51138-ACGLN
CD320 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51138-ACG
CD320 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51138-ACR
CD320 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51138-CF
CD320 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51138-NF
CD320 cDNA ORF Clone, Mouse, C-His tag MG51138-CH
CD320 cDNA ORF Clone, Mouse, N-His tag MG51138-NH
CD320 cDNA ORF Clone, Mouse, C-HA tag MG51138-CY
CD320 cDNA ORF Clone, Mouse, N-HA tag MG51138-NY
CD320 cDNA ORF Clone, Mouse, C-Myc tag MG51138-CM
CD320 cDNA ORF Clone, Mouse, N-Myc tag MG51138-NM

CD320 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CD320 cDNA ORF Clone in Cloning Vector, Human HG20389-U
CD320 cDNA ORF Clone, Human, untagged HG20389-UT
CD320 cDNA ORF Clone, Human, C-GFPSpark® tag HG20389-ACG
CD320 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG20389-ACGLN
CD320 cDNA ORF Clone, Human, C-OFPSpark® tag HG20389-ACR
CD320 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG20389-CF
CD320 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG20389-NF
CD320 cDNA ORF Clone, Human, C-His tag HG20389-CH
CD320 cDNA ORF Clone, Human, N-His tag HG20389-NH
CD320 cDNA ORF Clone, Human, C-HA tag HG20389-CY
CD320 cDNA ORF Clone, Human, N-HA tag HG20389-NY
CD320 cDNA ORF Clone, Human, C-Myc tag HG20389-CM
CD320 cDNA ORF Clone, Human, N-Myc tag HG20389-NM
info info
添加购物车成功! 添加购物车失败!